 INNOVATIVE ACID-LACTIC BACTERIA AND USE OF THE SAME
专利摘要:
a particular strain of bifidobacterium spp. or a particular strain of lactobacillus spp. according to the present invention it is isolated from human excrement or kimchi cabbage and, thus, is highly safe and has physiological activities as an immunity-regulating effect and an inhibitory effect of the inflammatory reaction. therefore, the particular strain of bifidobacterium spp. or the particular strain of lactobacillus spp. according to the present invention it can be used as a material to regulate immunity and inhibit inflammatory reactions and it can also be used as a functional food and pharmacological material useful to prevent, relieve or treat rhinitis, atopy and asthma, which are allergic diseases. 公开号:BR112019015806A2 申请号:R112019015806-5 申请日:2018-01-31 公开日:2020-03-31 发明作者:Kim Dong-Hyun；Joo Han Myung 申请人:University-Industry Cooperation Group Of Kyung Hee University；Navipharm Co, Ltd； IPC主号:
专利说明:
INNOVATIVE ACID-LACTIC BACTERIA AND USE OF THE SAME Technical Field [0001] The present invention relates to innovative acid-lactic bacteria and, more particularly, to innovative lactic acid bacteria and to their various uses in foods and drugs, which can inhibit allergic reactions through various physiological activities, such as a regulatory effect of immunity, an inhibitory effect of the inflammatory reaction, etc. Background [0002] A hypersensitivity reaction refers to a reaction that harms the human body, causing an excessive immune reaction to a non-pathogen, rather than causing an immune tolerance to it in a living human body. The hypersensitivity reaction is roughly classified into four types according to its mechanism of effect. A type 1 hypersensitivity reaction occurs in such a way that a particular antigen binds to Ig, which is mainly bound to a mast cell Fc receptor. Such a reaction is also called an immediate hypersensitivity reaction, since the reaction occurs immediately after exposure to the antigen. The type 1 hypersensitivity reaction is usually caused by particulate antigens inhaled through respiration. Examples of such particulate antigens are plant pollens, etc. Examples of diseases or symptoms caused by the type 1 hypersensitivity reaction are: acute urticaria, atopic dermatitis, allergic rhinitis, bronchial asthma, etc. A type 2 hypersensitivity reaction is caused by Petition 870190084989, of 08/30/2019, p. 7/95 2/88 small molecules that covalently bind to a component of the surface of human cells, thus creating a modified structure, which an immune system recognizes as a heterogeneous material. In the type 2 hypersensitivity reaction, B cells produce IgG against a new epitope, after which IgG binds to a modified cell and therefore causes cell disruption through complementary activity and phagocytosis. A type 3 hypersensitivity reaction is caused by soluble immune complexes, which are formed by the binding between a soluble protein antigen and IgG, which is produced against the soluble protein antigen. In the type 3 hypersensitivity reaction, a part of the immune complexes binds to a small blood vessel wall or to pulmonary alveoli in the lung, thus activating a complement, causing an inflammatory reaction that damages tissue and a deterioration of a physiological function of the fabric. A type 4 hypersensitivity reaction is caused by products of an antigen-specific effector T cell and is also called a delayed hypersensitivity reaction, because it appears one to three days after exposure to the antigen. [0003] The type 1 hypersensitivity reaction is an immediate IgE-mediated reaction. IgE antibodies are produced by plasma cells present mainly in the mucous membranes of the respiratory and digestive organs. Such IgE antibodies produced have a great affinity with the surface receptors of mast cells and basophils and, therefore, bind mainly to these cells. It's a sensitized state Petition 870190084989, of 08/30/2019, p. 8/95 3/88 in which the majority of mast cell and basophil surface receptors are bound to IgE antibodies. When exposed to an allergen in the sensitized state, the allergen binds to the IgE antibody, thus causing a reaction between receptors, after which a granule in the mast cell fuses with the cell membrane, thus secreting chemical mediators such as histamine, cysteinyl-leukotriene , prostaglandin and thromboxane. Such chemical mediators cause an early allergic reaction by increasing vascular permeability, widening blood vessels, contraction of smooth muscles and accelerating the functions of secretory glands. [0004] Allergic rhinitis, one of the diseases caused by the type 1 hypersensitivity reaction, refers to a symptomatic disorder, which causes symptoms in the nose, eyes, ears, throat and the like, by inducing an IgE-mediated inflammation after exposure to the allergen. Such allergic rhinitis is divided into intermittent RA or persistent RA based on the duration of symptoms, according to the Allergic Rhinitis and Its Impact on Asthma Working Group, and is further subdivided into mild, moderate and severe. The prevalence rate of allergic rhinitis is usually around 10-30% in adults and around 40% in young children, with a slight difference depending on country-by-country reports. Risk factors for allergic rhinitis are allergens from indoor and outdoor environments and in cases where a serum IgE level is 100 IU / ml or higher before the age of six. Allergic rhinitis can cause sinusitis, otitis media or conjunctivitis as Petition 870190084989, of 08/30/2019, p. 9/95 4/88 complication. If it progresses chronically, such a disease can aggravate asthma and sinusitis and, therefore, cause sleep disorders, difficulty in attention or maladjustment to social life. Asthma, one of the diseases caused by the type 1 hypersensitivity reaction, refers to a disease in which symptoms such as difficulty breathing, coughing, wheezing (wheezing during breathing), etc., occur repeatedly or in spasms, and also if refers to a representative allergic disease caused by a combination of genetic and environmental factors. In other words, such asthma occurs in such a way that an allergic constitution inherited from parents and environmental factors that induce asthma are involved in an interaction with each other, thus causing a disorder to an immune system and is mainly chronic and recurrent. [0005] Various therapeutic methods have been studied to treat allergic diseases caused by the type 1 hypersensitivity reaction. For example, antiallergic drugs, histamine receptor antagonists (antihistaminic agents), steroids, etc., have been used for treatment. However, it is known that all of the following have considerable side effects: antihistamine agents, which inhibit a signal transduction of peripheral nerves competing with histamine for binding to histamine receptors; antiallergic drugs, which try to reduce symptoms by weakening an activity of cells that produce chemical mediators; and steroids, which reduce inflammation by weakening the immune response, most of which do not have a reliable therapeutic effect. [0006] On the other hand, lactic acid bacteria are Petition 870190084989, of 08/30/2019, p. 10/95 5/88 a product that was first obtained by Metchnikoff who made an attempt to acidify the intestinal contents to prevent the growth of putrefied organisms and thus achieve a therapeutic effect. In the case of the genus Lactobacillus, which is believed to be a representative of lactic acid bacteria, more than 165 species of this genus have been found so far. As a way of life for probiotic lactic acid bacteria, which have been used for the treatment of allergic diseases, the L-92 strain of Lactobacillus acidophilus has been reported for allergic symptoms caused by Himalayan cedar pollens in Japan. [0007] Numerous lactic acid bacteria, which are beneficial to the human body, reside in the human digestive tract and research is underway to apply lactic acid bacteria isolated from the human digestive tract to medications or functional foods. In particular, therapeutic agents for allergic diseases may need to be taken over a long period of time and thus require features of ease of administration as well as high safety. Lactic acid bacteria belong to a group of candidates that are very suitable for the treatment of diseases as above and also satisfy the requirements of such treatment. Detailed Description of the Invention Technical Problem [0008] The present invention is applied against the conventional technological background and an objective of the present invention is to provide innovative lactic acid bacteria having an immunity regulating effect and a Petition 870190084989, of 08/30/2019, p. 11/95 6/88 inhibitory effect of the inflammatory reaction. [0009] In addition, another objective of the present invention is to provide various uses in foods and drugs of innovative lactic acid bacteria. [0010] Particularly, an objective of the present invention is to provide the innovative lactic acid bacteria of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 [0011] Another objective of the present invention is to provide a pharmaceutical composition, to prevent or treat allergic diseases, containing Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof. [0012] Another objective of the present invention is to provide a food composition to prevent or alleviate allergic diseases, containing Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof. [0013] Yet another objective of the present invention is to provide a pharmaceutical composition, to prevent or treat immune diseases or inflammatory diseases, containing Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof. [0014] Yet another object of the present invention is to provide a method for preventing or treating allergic diseases, including a step of administering Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof. [0015] Furthermore, another objective of the present invention is to provide a use of Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof in the prevention or treatment of allergic diseases. [0016] In addition, another objective of the present invention is Petition 870190084989, of 08/30/2019, p. 12/95 7/88 provide a use of Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof in the production of a drug to prevent or treat allergic diseases. [0017] In addition, yet another objective of the present invention is to provide a composition containing Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof for use in the prevention or treatment of allergic diseases. Technical Solution [0018] In one aspect to achieve said objectives, the present invention provides Bifidobacterium longum IM55 (depositary institution: Korean Culture Center for Microorganisms (KCCM - Korean Culture Center of Microorganisms), filing date: 20 January 2017, and accession number: KCCM11961P). [0019] The Bifidobacterium longum IM55 of the present invention is characterized by being an innovative lactic acid bacterium from Bifidobacterium longum isolated and identified from human excrement. A sequence of the 16S rDNA gene for identification and classification of Bifidobacterium longum IM55 of the present invention is the same as SEQ ID NO: 1 attached to this specification. Thus, the Bifidobacterium longum IM55 KCCM11961P of the present invention can include the 16S rDNA sequence of SEQ ID NO: 1. [0021] As a result of the analysis of said 16S rDNA sequence of SEQ ID NO: 1, such sequence was 99% homologous to that of known strains of Bifidobacterium longum, thus showing the highest molecular phylogenetic relationship Petition 870190084989, of 08/30/2019, p. 13/95 8/88 with Bifidobacterium longum. Thus, the said acid-lactic bacterium was identified as Bifidobacterium longum and then named as Bifidobacterium longum IM55 and then deposited with the KCCM on January 20, 2017 (accession number: KCCM11961P). [0022] In the present invention, said Bifidobacterium longum IM55 can use as carbon source D-glucose, Dmanitol, D-lactose, D-sucrose, D-maltose, salicine, Dxylose, L-arabinose, esculin ferric citrate, Drafinose and D-sorbitol. [0023] In another aspect to achieve said objectives the present invention provides Lactobacillus plantarum IM7 6 (depositary institution: Korean Culture Center of Microorganisms (KCCM), deposit date: January 20, 2017 and accession number: KCCM11962P). [0024] The Lactobacillus plantarum IM7 6 of the present invention is characterized by being an innovative lactic acid bacterium from Lactobacillus plantarum isolated and identified from kimchi, which is a traditional fermented food. A sequence of the 16S rDNA gene for identification and classification of Lactobacillus plantarum IM76 of the present invention is the same as SEQ ID NO: 2 attached to this specification. Thus, the Lactobacillus plantarum IM76 KCCM11962P of the present invention can include the 16S rDNA sequence of SEQ ID NO: 2. [0026] As a result of the analysis of said 16S rDNA sequence of SEQ ID NO: 2, such sequence was 99% homologous to that of known strains of Lactobacillus plantarum, thus showing the highest molecular phylogenetic relationship Petition 870190084989, of 08/30/2019, p. 14/95 9/88 with Lactobacillus plantarum. Thus, the said lactic acid bacteria was identified as Lactobacillus plantarum and then named as Lactobacillus plantarum IM76 and then deposited with the KCCM on January 20, 2017 (accession number: KCCM11962P). [0027] In the present invention, said Lactobacillus plantarum IM7 6 can use as a carbon source Larabinosis, D-ribose, D-galactose, D-glucose, D-fructose, Dmanose, mannitol, sorbitol, N-acetyl-glucosamine, tonsillin arbutin, esculin, salicine, cellobiosis, maltose, lactose, melibiosis, sucrose, trehalose, raffinose, gentiobiose, Dturanosis and gluconate. [0028] In another aspect to achieve said objectives the present invention provides a pharmaceutical composition to prevent or treat allergic diseases, containing Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof. [0029] In the present invention, the term allergic disease means a disease, disorder or abnormal state, which is induced causing hyperergy to a certain material in the human body, that is, causing an overreaction of an immune system against material brought in from outside . Said material brought in from outside may be an allergen, that is, an antigen that becomes a cause of allergic disease. Said allergy can mean the hypersensitivity reaction caused in such a way that an inflammation mediator, such as histamine, is released by means of a material brought in from the outside, thus causing a disease, and the said hypersensitivity reaction can be a reaction of type 1 hypersensitivity, a reaction of Petition 870190084989, of 08/30/2019, p. 15/95 10/88 hypersensitivity of type 2, a reaction in hypersensitivity of type 3 or a reaction in hypersensitivity type 4. In present invention, the said allergic disease can be a disease caused by the IgE-mediated type 1 hypersensitivity reaction and, in particular, can be selected from the group consisting of rhinitis, atopy, asthma, atopic dermatitis, allergic conjunctivitis, allergic otitis media, urticaria and anaphylactic shock . More particularly, said allergic disease in the present invention can be rhinitis, atopy or asthma. [0030] In addition to an effect of controlling, preventing, relieving and treating the above allergic diseases, a composition according to the present invention also has an excellent effect in controlling, preventing, relieving and treating allergic diseases and their complications through normalization intestinal microorganisms modified by allergic diseases. [0031] The Bifidobacterium longum IM55 of the present invention is the same as described above. [0032] In particular, the Bifidobacterium longum IM55 contained in the pharmaceutical composition of the present invention may be a living cell body thereof, a dead cell body thereof, a product of the culture thereof, a crushed product or an extract thereof, but any form of Bifidobacterium longum IM55 can be used without limitation, as long as it can achieve a preventive or therapeutic effect in allergic diseases. [0033] The Lactobacillus plantarum IM76 of the present invention is the same as described above. [0034] In particular, Lactobacillus plantarum IM7 6 Petition 870190084989, of 08/30/2019, p. 16/95 11/88 contained in the pharmaceutical composition of the present invention can be a living cell body thereof, a dead cell body thereof, a product of the culture thereof, a crushed product or an extract thereof, but any form of Lactobacillus plantarum IM7 6 it can be used without limitation, as long as it can achieve a preventive or therapeutic effect in allergic diseases. [0035] In the present invention, a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 can be mixed on a scale capable of achieving an effect of preventing or treating allergic diseases, and the said mixing ratio can be 10: 1 to 1 : 10, but without being limited to those. In particular, a ratio of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 can be 10: 1, 9: 1, 8: 1, 7: 1, 6: 1, 5: 1, 4: 1, 3: 1, 2: 1 , 1: 1, 1: 2, 1: 3, 1: 4, 1: 5, 1: 6, 1: 7, 1: 8, 1: 9 or 1:10. A mixture of them has a remarkable effect of preventing or treating allergic diseases through a synergistic effect, according to the mixture between such lactic acid bacteria [0036] In the present invention, the term living cell body means the lactic acid bacteria itself of the present invention; a dead cell body means a lactic acid bacteria that is sterilized by heating, pressurizing, drug treatment or the like; and a crushed product means a lactic acid bacterium that is crushed by means of enzymatic treatment, homogenization, ultrasonic treatment or the like. Furthermore, in the present invention, the term extract means a product obtained by extracting the lactic acid bacteria with an extraction solvent Petition 870190084989, of 08/30/2019, p. 17/95 Known 12/88. [0037] In the present invention, the term product of culture means a product obtained by cultivating lactic acid bacteria in a known medium and said product can include innovative lactic acid bacteria. Said medium can be selected from a known liquid medium or solid medium and can be, for example, an MRS liquid medium, a GAM liquid medium, an MRS agar medium, a GAM agar medium or a BL agar medium. , but without being limited to those. [0038] In addition, in the present invention, the term prevention means all acts that inhibit a symptom of allergic diseases or delay progress of such diseases by administering the pharmaceutical composition of the present invention. [0039] In addition, in the present invention, the term treatment means all acts that beneficially improve or alter a symptom of allergic diseases by administering the pharmaceutical composition of the present invention. [0040] A content of innovative lactic acid bacteria, etc., which are an effective component of the pharmaceutical composition of the present invention, can be adjusted within several ranges, depending on a specific form of the composition and a purpose or aspect of its use . In the pharmaceutical composition according to the present invention, the content of the effective component is not very limited and can be, for example, from 0.01 to 99% by weight, particularly from 0.1 to 75% by weight and more particularly from 0 , 5 to 50% by weight based on the total weight of the composition. Petition 870190084989, of 08/30/2019, p. 18/95 The pharmaceutical composition of the present invention may further contain at least one known effective component having an immunity-regulating effect, an inhibiting effect of the inflammatory reaction and an effect of preventing or treating allergic diseases (for example, asthma , rhinitis, atopic dermatitis, etc.). [0042] In particular, the pharmaceutical composition of the present invention may additionally contain at least one selected from the group including chitosan, inulin and citrus pectin. [0043] Said chitosan, inulin, citrus pectin or mixtures of at least two of these are contained in the pharmaceutical composition of the present invention and, therefore, can act as a prebiotic when innovative acid-lactic bacteria achieve an effect of prevention and treatment of allergic diseases. [0044] In addition, the pharmaceutical composition according to the present invention may additionally contain additives such as pharmaceutically acceptable carriers, in addition to the innovative lactic acid bacteria, which are an effective component. The carrier, which may be contained in the pharmaceutical composition of the present invention, includes lactose, sucrose dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil and the like, but be limited to these. [0045] The pharmaceutical composition of the present invention Petition 870190084989, of 08/30/2019, p. 19/95 14/88 can be formulated in a pharmaceutical form for oral administration or in a pharmaceutical form for parenteral administration by a conventional method and can be formulated using diluents or excipients such as fillers, extension agents, binders, humectants, disintegrating agents , surfactants, etc., which are generally used to be formulated in a preparation. [0046] If formulated in a solid preparation for oral administration, the pharmaceutical composition of the present invention can include tablets, pills, powders, granules, encapsulated preparations, etc., and such solid preparations can contain at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin or similar in its effective component. In addition, in addition to simple excipients, the solid preparation may contain lubricants, etc., such as magnesium stearate and talc, but not limited to them. [0047] If formulated in a liquid preparation for oral administration, the pharmaceutical composition of the present invention may include suspending agents, liquid for internal use, emulsion, syrup and the like, and may also contain various excipients, for example, humectants , sweeteners, flavoring agents, preservatives, etc., in addition to water and liquid paraffin, which are simple diluents frequently used, but not limited to these. [0048] If formulated in a preparation for parenteral administration, the pharmaceutical composition of the present invention may include sterile aqueous solution, non-aqueous solvent, suspending agents, emulsion, Petition 870190084989, of 08/30/2019, p. 20/95 15/88 lyophilized preparations or suppositories. As the non-aqueous solvent and the suspension solvent, the following can be included, without limitation: propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, etc. As a basis for suppositories, the following can be used: witepsol, macrogol, tween 61, cocoa butter, laurinum, glycerogelatin, etc. [0049] The pharmaceutical composition of the present invention can be administered orally or parenterally to mammals, including humans, according to a desired method. As the method of parenteral administration, there is external use in the skin, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intrathoracic injection methods, or the like. As long as it is a pharmaceutically effective amount, a dosage of the pharmaceutical composition of the present invention is not very limited and its range varies depending on weight, age, sex, state of health, diet, time of administration, method of administration, rate of excretion and severity of an illness of the patient. A conventional daily dosage of the pharmaceutical composition of the present invention is not very limited, but it can be particularly from 0.1 to 3000 mg / kg and more particularly from 0.5 to 2000 mg / kg based on the effective component, and can be administered once a day or divided into several times a day. [0050] Said pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable risk / benefit ratio applicable to the Petition 870190084989, of 08/30/2019, p. 21/95 16/88 treatment doctor, and can to be determined according with factors including the type and gravity gives disease of one individual, activity in one drug, sensitivity to drug, time of administration, route of administration, rate of excretion, period of treatment and a drug used simultaneously, as well as other factors well known in the pharmaceutical field. [0051] Said administration means providing a predetermined pharmaceutical composition of the present invention to an individual by any appropriate method. At this point, the individual refers to animals, and may typically be mammals, in which treatment using the innovative lactic acid bacteria of the present invention can show a beneficial effect. A preferable example of such an individual may include primates such as humans. In addition, such an individual may include all individuals with a symptom of allergic diseases, or with a risk of having such a symptom. [0052] Furthermore, in another aspect to achieve said objectives, the present invention provides a food composition to prevent or alleviate allergic diseases containing Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof. [0053] In the present invention, the terms Bifidobacterium longum IM55, Lactobacillus plantarum IM76, allergic disease and the like are the same as described above. [0054] The food composition of the present invention can be used as a functional food for health. This functional health food means a Petition 870190084989, of 08/30/2019, p. 22/95 17/88 food prepared and processed using a raw material or component that has useful functionality for the human body according to Health Functional Food Acts and functionality means ingesting such food for adjustment purposes of nutrients in relation to structures and functions of the human body or to obtain a valuable effect for healthy uses such as a physiological action, etc. [0055] The food composition of the present invention may contain conventional food additives and the decision whether a particular item is suitable as said food additives or is not made based on specifications and standards on that item, in accordance with general rules, others general testing and similar methods of the Food Additive Code approved by the Ministry of Food and Drug Safety, unless other regulations exist. [0056] The items listed in the said Food Additives Code can be, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, cinnamic acid, etc .; natural additives such as khaki color, licorice extract, crystalline cellulose, kaoliang (or sorghum) color, guar gum, etc .; and mixed formulations such as sodium L-glutamate formulation, alkaline pasta additives, preservative formulation, tar color formulation, etc. [0057] The food composition of the present invention may contain Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof in an amount of Petition 870190084989, of 08/30/2019, p. 23/95 18/88 0.01 to 99% by weight, particularly from 0.1 to 75% by weight and more particularly from 0.5 to 50% by weight based on the total weight of the composition. [0058] In addition, the food composition of the present invention can be prepared and processed in the form of tablets, capsules, powder, granules, liquid, pills, etc., for the purpose of preventing and / or relieving allergic diseases [0059] for example, the food composition in said tablet form can be prepared by granulating Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof and mixtures of excipients, binders, disintegrating agents and other additives by a conventional method; then, placing sliding agents, etc .; and then, by performing compression molding, or it can be prepared by directly placing said mixtures in the compression molding. In addition, the functional health food in said tablet form may contain correction agents, etc., if necessary, and may be coated with an appropriate coating agent, if necessary. [0060] From food compositions in capsule form, a hard capsule preparation can be prepared by filling conventional hard capsules with Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof and mixtures of additives such as excipients, etc .; or granules or granules coated therewith in conventional hard capsules, and a soft capsule preparation can be prepared by filling gelatin-based capsules, etc. with Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof and Petition 870190084989, of 08/30/2019, p. 24/95 19/88 mixtures of additives such as excipients, etc. Said soft capsule preparation may contain plasticizers, dyes, preservatives, etc., such as glycerin, sorbitol or the like, if necessary. [0061] The food composition in pill form can be formulated by molding Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof and mixtures of excipients, binders, disintegrating agents, etc., by an appropriate method, and can be coated with white sugar or other suitable coating agents, or can be coated with a pill coating agent by means of starch, talc or suitable materials, if necessary. [0062] The food composition in granule form can be prepared in a granulated form with Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof and mixtures of excipients, binders, disintegrating agents, etc., by an appropriate method, and can contain flavoring agents, correction agents, etc., if necessary. After performing a granularity test on the functional health food in the form of a granule with sieves No. 12 (1680 pm), No. 14 (1410 pm) and No. 45 (350 pm), the total quantity passes through the sieve No. 12 5% or less of the total quantity is retained in sieve No. 14 and 15, 0% or less of the total quantity can pass through sieve No. 45. [0063] The definition of terms such as said excipients, binders, disintegrating agent, gliding agents, correction agents, flavoring agents, etc., includes those that have the same or similar functions Petition 870190084989, of 08/30/2019, p. 25/95 20/88 those described in known documents in the art (Korean edition an explanatory Pharmacopoeia (Korean Pharmacopoeia), Munseong Publishing, Korean Association of Colleges of Pharmacy, 5 the revised edition, p33-48, 1989) [0064] A The type of said food is not particularly limited. As an example of food, to which an extract of the present invention can be added, there are drinks, chewing gums, vitamin complexes, drinks, etc., including food compositions in a conventional sense, in particular, all functional foods for health . [0065] Furthermore, in another aspect to achieve said objectives, the present invention provides a pharmaceutical composition to prevent or treat allergic diseases or inflammatory diseases containing Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof. [0066] In the present invention, the terms related to the pharmaceutical composition, including Bifidobacterium longum IM55 and Lactobacillus plantarum IM7 6 are the same as described above. [0067] In the present invention, the term immune disease means a disease that becomes problematic with the occurrence of a particular immune reaction and, in particular can be an autoimmune disease, transplant rejection, or graft versus host disease, but without being limited to those. Autoimmune disease can be Crohn's disease, erythema, rheumatoid arthritis, Hashimoto's thyroiditis, pernicious anemia, Addison's disease, type 1 diabetes, lupus, chronic fatigue syndrome, fibromyalgia hypothyroidism and hyperthyroidism syndrome, scleroderma, disease Petition 870190084989, of 08/30/2019, p. 26/95 21/88 de Behçet, inflammatory bowel disease, multiple sclerosis, myasthenia gravis, Meniere's syndrome, Guillain-Barre, Sjogren's syndrome, leukoplakia, endometriosis, psoriasis, leukoplakia, systemic scleroderma, asthma, ulcerative colitis or the like. [0068] In the present invention, the term inflammatory disease collectively means diseases whose main injury is inflammation. The inflammatory disease of the present invention can be at least one selected from the group that includes arthritis, gout, hepatitis, obesity, corneal, gastritis, enteritis, nephritis, colitis, diabetes, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, cystitis, vaginitis, arteriosclerosis, septicemia, burn, dermatitis, periodontitis and gingivitis. Particularly, said inflammatory disease can be colitis. [0069] In addition to an effect of controlling, preventing, relieving and treating the inflammatory diseases above, the composition according to the present invention also has an excellent effect in the control, prevention, relief and treatment of inflammatory diseases and their complications through normalization intestinal microorganisms, which are modified by inflammatory diseases. [0070] In addition, in another aspect to achieve said objectives, the present invention provides a food composition to prevent or treat immune diseases or inflammatory diseases containing Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof. [0071] In the present invention, terms related to Petition 870190084989, of 08/30/2019, p. 27/95 22/88 food composition, including Bifidobacterium longum IM55 and Lactobacillus plantarum IM7 6 are the same as described above. [0072] Furthermore, in another aspect to achieve said objectives, the present invention provides a method for preventing or treating allergic diseases including a step of administering Bifidobacterium longum IM55 KCCM11961P Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof to an individual. [0073] In the present invention, terms such as Bifidobacterium longum IM55, Lactobacillus plantarum IM76, administration, individual, allergic disease and the like are the same as described above. [0074] In addition, in another aspect to achieve said objectives, the present invention provides a use of Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof in the prevention or treatment of allergic diseases. [0075] In addition, in another aspect to achieve said objectives, the present invention provides a use of Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof in the production of a drug to prevent or treat allergic diseases. [0076] In addition, in another aspect to achieve said objectives, the present invention provides a composition containing Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof for use in the prevention or treatment of allergic diseases. Petition 870190084989, of 08/30/2019, p. 28/95 Additionally, in another aspect to achieve said objectives, the present invention provides a method for preventing or treating immune diseases or inflammatory diseases including a step of administering Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures of them to an individual. [0078] In the present invention, terms such as Bifidobacterium longum IM55, Lactobacillus plantarum IM76, administration, individual, immune disease, inflammatory disease and the like are the same as described above. [0079] In addition, in another aspect to achieve said objectives, the present invention provides a use of Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof in the prevention or treatment of immune diseases or inflammatory diseases. [0080] In addition, in another aspect to achieve said objectives, the present invention provides a use of Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof in the production of a drug to prevent or treat immune diseases or inflammatory diseases . [0081] In addition, in another aspect to achieve said objectives, the present invention provides a composition containing Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof for use in the prevention or treatment of immune diseases or inflammatory diseases. Petition 870190084989, of 08/30/2019, p. 29/95 24/88 Advantageous Effects [0082] Bifidobacterium longum IM55 or Lactobacillus plantarum IM76, according to the present invention, are safe, without toxicity to the human body, have excellent physiological activities, as an immunity-regulating effect and an inhibitory effect of the inflammatory reaction and have a normalizing effect of intestinal microorganisms. Thus, Bifidobacterium longum IM55, Lactobacillus plantarum IM7 6 or mixtures thereof can be used as a material to prevent, relieve or treat not only allergic diseases, but also immune and inflammatory diseases. Brief Description of the Drawings [0083] Fig. 1 is a graph that identifies that an IL-10 concentration is increased by treating macrophages with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 (NOR is a normal control group; LPS is a group with induced inflammatory reactions; 155 is a group with induced inflammatory reactions + treated with Bifidobacterium longum IM55 at ΙχΙΟ 5 CFU / ml; and 176 is a group with induced inflammatory reactions + treated with Lactobacillus plantarum IM76 at 1 * 10 5 CFU / ml and are , hereinafter, the same as in Figures 2 to 4). [0084] Fig. 2 is a graph that identifies that an IL-12 concentration is reduced by treating macrophages with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76. [0085] Fig. 3 is a graph that identifies what an concentration of IL-10 is increased fur treatment in cells dendritic with Bifidobacterium longum IM55 or Petition 870190084989, of 08/30/2019, p. 30/95 25/88 Lactobacillus plantarum IM76. [0086] Fig. 4 is a graph that identifies that a concentration of TNF-α is reduced by treating dendritic cells with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76. [0087] Fig. 5 is a graph that identifies that a level of GATA3 expression is inhibited as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 after inducing differentiation of T cells into Th2 cells (NOR is a control group normal; Thl is a group treated with a Th2 cytodifferentiation inductor; 155 is a group with induced Th2 cytodifferentiation + treated with Bifidobacterium longum IM55 at ΙχΙΟ 5 CFU / ml; and 176 is a group with induced Th2 cytodifferentiation + treated with Lactobacillus plantarum IM76 at 1 * 10 5 CFU / ml and are henceforth the same as in Fig. 6). [0088] Fig. 6 is a graph that identifies that an IL-5 expression level is inhibited as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 after inducing differentiation of T cells into Th2 cells. [0089] Fig. 7 is a graph that identifies that a concentration of FOXp3 is increased as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 after inducing differentiation of T cells into Treg cells (NOR is a normal control group ; TrI is a group treated with a Treg cytodifferentiation inductor; 155 is a group with Treg + induced cytodifferentiation treated with Bifidobacterium longum IM55 at 1 * 10 5 CFU / ml; and 176 is a group with induced Treg + Petition 870190084989, of 08/30/2019, p. 31/95 26/88 treated with Lactobacillus plantarum IM76 at ΙχΙΟ 5 CFU / ml and are, from now on, the same as in Fig. 8). [0090] Fig. 8 is a graph that identifies that an IL-10 expression level is increased as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 after inducing differentiation of T cells into Treg cells. [0091] Fig. 9 is a graph that identifies that a serum concentration of IL-5 is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with induced allergic rhinitis and asthma (NOR is a normal control group (administered orally only with PBS); CON or RA are a group with an induced disease; DX is a group with an induced disease + treated intraperitoneally with dexamethasone at 1 mg / kg bw; 155 is a group with a disease induced + treated orally with Bifidobacterium longum IM55 at ΙχΙΟ 9 CFU / mouse; and 17 6 is a group with an induced disease + treated orally with Lactobacillus plantarum IM7 6 at ΙχΙΟ 9 CFU / mouse and are, from now on, the same as in Figures 10 to 17). [0092] Fig. 10 is a graph that identifies that a serum IgE concentration is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0093] Fig. 11 is a graph that identifies that a serum concentration of IL-4 is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0094] Fig. 12 is a graph that identifies that a Petition 870190084989, of 08/30/2019, p. 32/95 27/88 IL-5 concentration in bronchoalveolar lavage fluid (FLBA) is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with induced allergic rhinitis and asthma. [0095] Fig. 13 is a graph that identifies that an IL-4 concentration in the FLBA is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0096] Fig. 14 is a graph that identifies that a rate of distribution of Th2 cells in FLBA is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0097] Fig. 15 is a graph that identifies that a distribution rate of eosinophils in the FLBA is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0098] Fig. 16 is a graph that identifies that a concentration of IL-10 in the FLBA is increased by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0099] Fig. 17 is a graph that identifies that a distribution rate of Treg cells in the FLBA is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with induced allergic rhinitis and asthma. [0100] Fig. 18 is a graph that identifies that a Petition 870190084989, of 08/30/2019, p. 33/95 28/88 rhinitis symptom score (sneezing and nasal rubbing) is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM7 6 in an animal model with induced allergic rhinitis and asthma (NOR is a normal control group (administered orally) only with PBS); RA is a group with an induced disease; DX is a group with an induced disease + treated intraperitoneally with dexamethasone at 1 mg / kg bw; 155 is a group with an induced disease + treated orally with Bifidobacterium longum IM55 at Ix10 9 CFU / mouse; and 17 6 is a group with an induced disease + treated orally with Lactobacillus plantarum IM76 at 1 * 10 9 CFU / mouse and are, henceforth, the same as in Figs. 19 to 26). [0101] Fig. 19 is a graph that identifies that a concentration of IL-4 in the nasal cavity is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0102] Fig. 20 is a graph that identifies that a concentration of IL-5 in the nasal cavity is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with allergic rhinitis and induced asthma. [0103] Fig. 21 is a graph that identifies that a disorder in the nasal cavity and the expansion of epithelial cells in the nasal cavity are reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 in an animal model with induced allergic rhinitis and asthma. [0104] Fig. 22 is a graph that identifies that a Petition 870190084989, of 08/30/2019, p. 34/95 29/88 level of GATA3 expression in lung tissues is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM7 6 in an animal model with induced allergic rhinitis and asthma. [0105] Fig. 23 is a graph that identifies that an expression level of IL-10 in lung tissues is increased by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM7 6 in an animal model with induced allergic rhinitis and asthma. [0106] Fig. 24 is a graph that identifies that an expression level of FOXp3 in lung tissues is increased by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM7 6 in an animal model with induced allergic rhinitis and asthma. [0107] Fig. 25 is a graph that identifies that an expression level of IL-5 in the lung tissues is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM7 6 in an animal model with induced allergic rhinitis and asthma. [0108] Fig. 26 is a graph that identifies that a degree of inflammation and edema induction in lung tissues is reduced by administration of Bifidobacterium longum IM55 or Lactobacillus plantarum IM7 6 in an animal model with induced allergic rhinitis and asthma. [0109] Fig. 27 is a graph that identifies that a score of rhinitis symptoms (sneezing and nasal rubbing) and a concentration of IL-5 in the nasal cavity are reduced by administering a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 (in a 1: 1, 1: 3 and 1: 9 ratio) in an animal model with allergic rhinitis and Petition 870190084989, of 08/30/2019, p. 35/95 30/88 induced asthma (NOR is a normal control group (administered orally only with PBS only); RA is a group with an induced disease; DX is a group with an induced disease + treated by intraperitoneal administration with 1 mg dexamethasone / kg pc; 1: 1 is a group administered orally with a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 at a ratio of 1: 1 (total IxlO 9 UFC / mouse): 1: 3 is a group administered orally with a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 at a ratio of 1: 3 (total Ix10 9 CFU / mouse) and 1: 9 is a group administered orally with a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 at a 1: 9 ratio (total Ix10 9 CFU / mouse) and are, from now on, the same as in Fig. 28). [0110] Fig. 28 is a graph that identifies that a level of IL-5 expression in the serum is reduced by administration of a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 (at a ratio of 1: 1, 1: 3 and 1: 9) in an animal model with allergic rhinitis and induced asthma. [0111] Fig. 29 is a graph that identifies that a concentration of IL-4 and IL-5 in the colon is reduced and a concentration of IL-10 in the colon is increased by administration of Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures of the same in an animal model with allergic rhinitis and induced asthma (NOR is a normal control group (administered orally only with PBS only); RA is a group with an induced disease; DX is a group with an induced + treated disease intraperitoneal with dexamethasone Petition 870190084989, of 08/30/2019, p. 36/95 31/88 at 1 mg / kg bw; 155 is a group with an induced disease + treated orally with Bifidobacterium longum IM55 at lx 10 9 CFU / mouse; and 17 6 is a group with an induced disease + treated orally with Lactobacillus plantarum IM76 at lx 10 9 CFU / mouse; and PM is a group with an induced disease + treated orally with Bifidobacterium longum IM55 and Lactobacillus plantarum IM7 6 each at 5χ10 8 CFU / mouse and are, from now on, the same as in Fig. 30). [0112] Fig. 30 is a graph that identifies that a constitution of intestinal microorganisms is altered by administration of Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixture of them in an animal model with induced allergic rhinitis and asthma. Mode for the Invention [0113] Hereinafter, the present invention will be described in more detail through exemplary modalities. However, the following exemplary embodiments are offered only to more clearly illustrate the technical characteristics of the present invention but should not be construed as limiting the scope of protection of the present invention. Example 1. Isolation and identification of acid-lactic bacteria (1) Isolation of acid-lactic bacteria [0114] The excrement of a healthy person of about 20 years old who lives in Seoul, or of a healthy person of about 60 years of age. age living in Gurye, Jeollanam-do province, or home made cabbage kimchi was inserted and suspended in GAM broth (Nissui Petition 870190084989, of 08/30/2019, p. 37/95 32/88 Pharmaceutical, Japan). After that, the supernatant was separated and transplanted on an MRS agar medium (Difco, USA) or a GAM agar medium (Nissui Pharmaceutical, Japan). The resulting medium was cultured anaerobically at 37 ° C for about 48 hours and, after that, strains of Lactobacillus spp. and Bifidobacterium spp. that had formed colonies were isolated from it. (2) Identification of isolated lactic acid bacteria [0115] Regarding strains isolated from human excrement or kimchi from cabbage, their species were confirmed and their names were given according to the gram stain, characteristics physiological, 16S rDNA sequences and the like of such strains. Management numbers and strain names given to isolated lactic acid bacteria are shown in tables 1 and 2 below. The lactic acid bacteria isolated from human excreta were 15 species of Bifidobacterium longum (management n ° 51 to 65 of table 1), 10 species of Bifidobacterium adolescentis (management n ° 66 to 75 of table 1) and 10 species of Lactobacillus acidophilus ( management n ° 90 to 99 of table 2), while the lactic acid bacteria isolated from cabbage kimchi were 14 species of Lactobacillus plantarum (management n ° 76 to 89 of table 2). [Table 11 No.management Strain name No.management Strain name 51 Bifidobacteri um IM51 longum 64 Bifidobacteri um IM64 longum 52 Bifidobacterium 65 Bifidobacteri um Petition 870190084989, of 08/30/2019, p. 38/95 33/88 No.management Strain name No.management Strain namelongum IM52longum IM65 53 Bifidobacteríum longum IM53 66 Bifídobacteri um adolescentis IM66 54 Bifidobacterium longum IM54 67 Bifídobacteri um adolescentis IM67 55 Bifidobacterium longum IM55 68 Bifídobacteri um adolescentis IM68 56 Bifidobacterium longum IM56 69 Bifídobacteri um adolescentis IM69 57 Bifidobacterium longum IM57 70 Bifídobacteri um adolescentis IM70 58 Bifidobacteriumlongum IM58 71 Bifídobacterium adolescentis IM71 59 Bifidobacterium longum IM59 72 Bifidobacterium adolescentis IM72 60 Bifidobacterium longum IM60 73 Bifidobacterium adolescentis IM73 61 Bifidobacterium longum IM61 74 Bifidobacterium adolescentis IM74 62 Bifidobacterium longum IM62 75 Bifidobacterium adolescentis IM75 63 Bifidobacterium longum IM63 Petition 870190084989, of 08/30/2019, p. 39/95 34/88 [Table 2] No.management Strain name No.management Strain name 76 Lactobacillus plantarum IM76 88 Lactobacillusplantarum IM88 77 Lactobacillusplantarum IM77 89 Lactobacillus plantarum IM89 78 Lactobacillusplantarum IM78 90 Lactobacillus acidophilus IM90 79 Lactobacillus plantarum IM79 91 Lactobacillus acidophilus IM91 80 Lactobacillus plantarum IM80 92 Lactobacillus acidophilus IM92 81 Lactobacillusplantarum IM81 93 Lactobacillus acidophilus IM93 82 Lactobacillusplantarum IM82 94 Lactobacillus acidophilus IM94 83 Lactobacillus plantarum IM83 95 Lactobacillus acidophilus IM95 84 Lactobacillusplantarum IM84 96 Lactobacillus acidophilus IM96 85 Lactobacillus plantarum IM85 97 Lactobacillus acidophilus IM97 86 Lactobacillus plantarum IM86 98 Lactobacillus acidophilus IM98 87 Lactobacillus 99 Lactobacillus Petition 870190084989, of 08/30/2019, p. 40/95 35/88 No.management Strain name No.management Strain nameplantarum IM87acidophilus IM99 [0116] In addition to the strains described in Table 1 above, it has been identified that Bifidobacterium longum IM55 is a gram-positive bacillus, which does not have a catalase activity and does not have a spore. In addition, it was shown that the 16S rDNA of Bifidobacterium longum IM55 has a sequence of SEQ ID NO: 1. As a result of the comparison of the 16S rDNA sequences of Bifidobacterium longum IM55 by means of BLAST research, it was demonstrated that a strain of Bifidobacterium longum with the same 16S rDNA sequence and that this sequence is 99% homologous to the 16S rDNA sequence of a known Bifidobacterium longum strain. Additionally, in addition to the physiological characteristics of Bifidobacterium longum IM55, the availability of the carbon source was analyzed with a sugar fermentation test using an API kit (model name: API 20 strep; and manufacturer: BioMerieux, USA), in which the its results are shown in table 3. In table 3 below, + indicates that the availability of the carbon source is positive and indicates that the availability of the carbon source is negative. [Table 3] Source of Strain name Source of Strain name carbon Bifidobacterium longum IM55 carbon Bifidobacterium longum IM55 L- - Gelatine - Petition 870190084989, of 08/30/2019, p. 41/95 36/88 Source ofcarbon Strain name Source ofcarbon Strain name Bifidobacterium longum IM55 Bifidobacterium longum IM55 tryptophan Urea - Ferric esculin citrate + D-glucose + Glycerol - D-mannitol + D-cellobiosis - D-lactose + D-mannose - D-sucrose + D-melezitosis - D-maltose + D-raffinose + Salicin + D-sorbitol + D-xylose + D-rhamnose - L-arabinose + D-trehalose - [0117] In addition to the strains described in Table 2 above, it has been identified that Lactobacillus plantarum IM76 is a gram-positive bacillus. Furthermore, it was demonstrated that the 16S rDNA of Lactobacillus plantarum IM76 has a sequence of SEQ ID NO: 2. As a result of the comparison of the 16S rDNA sequences of Lactobacillus plantarum IM76 by means of BLAST research, it was demonstrated that no one was found strain of Lactobacillus plantarum with the same 16S rDNA sequence and that this sequence was 99% homologous to the 16S rDNA sequence of a known Lactobacillus plantarum strain. Petition 870190084989, of 08/30/2019, p. 42/95 37/88 Additionally, in addition to the physiological characteristics of Lactobacillus plantarum IM76, the availability of the carbon source was analyzed with a sugar fermentation test using an API kit (model name: API 50 strep; and manufacturer: BioMerieux, USA), in which the its results are shown in table 4 below. In table 4 below, + indicates that the availability of the carbon source is positive and indicates that the availability of the carbon source is negative. [Table 4] Source ofcarbon Strain name Source ofcarbon Strain name Lactobacillus plantarumIM7 6 Lactobacillus plantarumIM7 6 Glycerol - Salicin + Erythritol - Cellobiosis + D-arabinose - Maltose + L-arabinose + Lactose + D-ribose + Melibiosis + D-xylose - Sucrose + L-xylose - Trealose + D-adonitol - Inulin - Methyl-β-Ο-xylopyranoside - Melezitosis - D-galactose + Rafinose + D-glucose + Starch - D-fructose + Glycogen - Petition 870190084989, of 08/30/2019, p. 43/95 38/88 Source ofcarbon Strain name Source ofcarbon Strain name Lactobacillus plantarumIM7 6 Lactobacillus plantarumIM7 6 D-mannose + Xylitol - L-sorbose - Gentiobiosis + L-rhamnose - D-turanosis + Dulcitol - D-lyxosis - Inositol - D-tagatose - Mannitol + D-fucose - Sorbitol + L-fucose - α-methyl-D-mannoside - D-arabitol - α-methyl-D-glycoside - L-arabitol - N-acetyl-glucosamine + Gluconate + Amygdalin + 2-keto-gluconate - Arbutin + 5-keto-gluconate - Esculina + Example 2. Test on the inhibitory effect of the inflammatory reaction of lactic acid bacteria (1) Test on the inhibitory effect of the inflammatory reaction of lactic acid bacteria on macrophages [0118] A six week old male C57BL / 6J mouse Petition 870190084989, of 08/30/2019, p. 44/95 39/88 age (20-23 g) was purchased from Raonbio Co., Ltd. 2 ml of sterile 4% thioglycolate was administered intraperitoneally to the mouse, which was then anesthetized 96 hours later. After that, 8 ml of RPMI 1640 medium was administered intraperitoneally to the mouse. After 5 to 10 minutes, the RPMI medium (including macrophages) was extracted intraperitoneally from the mouse, then centrifuged at 1000 rpm for 10 minutes and then washed twice with the RPMI 1640 medium. The macrophage was plated on a 24-plate plate. wells at 0.5 x 10 6 cells per well, then cultured for 24 hours and then the loose cells were removed from the culture. The macrophage culture fluid was treated with a test material, that is, lactic acid bacteria as well as an inflammatory reaction inducer, that is, lipopolysaccharide (LPS) for 90 minutes or 24 hours, and then the supernatant and cells. At that time, the treatment concentration of the lactic acid bacteria was 1 * 10 4 CFU / ml. In addition, to compare the effects of lactic acid bacteria, several prebiotics were used as test material. [0119] A TNF-α expression level of said obtained supernatant was measured with an ELISA kit. In addition, the level of expression of p65 (NF-κΒ), p-p65 (ΝΕ-κΒ-phosphorus) and β-actin was measured from said cells obtained with an immunoblotting method. In particular, 50 pg of the supernatant was separated and subjected to 10% (w / v) SDS polyacrylamide gel electrophoresis for one and a half hours. The sample submitted to electrophoresis was transferred to nitrocellulose paper Petition 870190084989, of 08/30/2019, p. 45/95 40/88 at 100 V and 400 mA conditions for one hour and 10 minutes. The nitrocellulose paper, to which the sample was transferred, was subjected to blocking with 5% skim milk for 30 minutes and then washed with PBSTween three times for five minutes each, and then subjected to overnight reaction with the addition of primary antibodies (Santa Cruz Biotechnology, USA) at a ratio of 1: 100. After that, such paper was washed three times for ten minutes each and subjected to the reaction with the addition of secondary antibodies (Santa Cruz Biotechnology, USA) at a ratio of 1: 1000 for an hour and 20 minutes. Then, this paper was washed for three times of 15 minutes each and then subjected to the formation of fluorescent staining, developed and the intensity of the chromophore band was measured. The results of the tests for the inhibitory effect of the inflammatory reaction of lactic acid bacteria on the macrophage are shown in tables 5 to 7. [Table 5] Test material for macrophage treatment Inhibition rate of NF-kB activation (p-p65 / p65) Inhibition rate of expression ofTNF-a Not treated - - Bifidobacterium longumIM51 + + Bifidobacterium longumIM52 ++ ++ Bifidobacterium longum ++ ++ Petition 870190084989, of 08/30/2019, p. 46/95 41/88 Test material for macrophage treatment Inhibition rate of NF-κΒ activation (p-p65 / p65) Inhibition rate of expression ofTNF-a IM53 Bifidobacterium longumIM54 + + + Bifidobacterium longumIM55 + + + + + + Bifidobacterium longumIM5 6 + + + + Bifidobacterium longumIM57 + + Bifidobacterium longumIM58 + + Bifidobacterium longumIM59 + + Bifidobacterium longumIM60 + + Bifidobacterium longumIM61 + + Bifidobacterium longumIM62 + + Bifidobacterium longumIM53 + + Bifidobacterium longumIM64 + + Bifidobacterium longum + + Petition 870190084989, of 08/30/2019, p. 47/95 42/88 Test material for macrophage treatment Inhibition rate Inhibition rate of expression ofTNF-a givesNF- kB activation (p-p65 / p65) IM65 Bifídobacteri um adolescentis IM66 + + + + Bifidobacterium adolescentis IM67 + + Bifídobacteri um adolescentis IM68 + + Bifídobacterium adolescentis IM69 + + Bifídobacteri um adolescentis IM70 + + Bifídobacterium adolescentis IM71 + + [Table 6] Test material for macrophage treatment Inhibition rate Inhibition rate of expression ofTNF-a givesNF- activation of-kB (p-p65 / p65) Bifidobacterium adolescentis IM72 + + Bifidobacterium adolescentis IM73 + + Petition 870190084989, of 08/30/2019, p. 48/95 43/88 Test material for macrophage treatment Inhibition rate Inhibition rate of expression ofTNF-a givesNF- kB activation (p-p65 / p65) Bifidobacterium adolescentis IM74 + + Bifidobacterium adolescentis IM75 + + Lactobacillus plantarum IM76 + + + + + + Lactobacillusplantarum IM77 + + + Lactobacillusplantarum IM78 + + Lactobacillusplantarum IM7 9 + + + Lactobacillus plantarum IM80 + + Lactobacillusplantarum IM81 + + + + + + Lactobacillusplantarum IM82 + + Lactobacillus plantarum IM83 + + Lactobacillusplantarum IM84 + + Lactobacillus plantarum IM85 + + Petition 870190084989, of 08/30/2019, p. 49/95 44/88 Test material for macrophage treatment Inhibition rate Inhibition rate of expression ofTNF-a givesNF- kB activation (p-p65 / p65) Lactobacillus plantarum IM86 + + Lactobacillusplantarum IM87 + + + + Lactobacillusplantarum IM88 + + Lactobacillus plantarum IM89 + + Lactobacillus acidophilus IM90 + + Lactobacillus acidophilus IM91 + + + + + + Lactobacillus acidophilus IM92 + + Lactobacillus acidophilus IM93 + + [Table 7] Test material for macrophage treatment Inhibition rate of NF-κΒ activation (pp65 / p65) Inhibition rate of expression ofTNF-a Lactobacillus acidophilus + + Petition 870190084989, of 08/30/2019, p. 50/95 45/88 Test material for macrophage treatment Inhibition rate of NF-κΒ activation (pp65 / p65) Inhibition rate of expression ofTNF-a IM94 Lactobacillus acidophilusIM95 + + Lactobacillus acidophilusIM96 + + Lactobacillus acidophilusIM97 + + Lactobacillus acidophilusIM98 + + Lactobacillus acidophilusIM99 + + Inulin + + + + Citrus pectin + + + Carragena + - Trealose + - Lactulose + - Cyclodextrin + - Carboxymethylcellulose + + Gelatine + + Chitosan + + ++ Alginic acid + + Fructo-oligosaccharides + + Soy protein + + Petition 870190084989, of 08/30/2019, p. 51/95 46/88 Test material for macrophage treatment Inhibition rate of NF-κΒ activation (pp65 / p65) Inhibition rate of expression ofTNF-a defatted Apple pectin + + + Arabinogalactana + + + Xylan + - * Inhibition rate: -, <10%; +, 10-30%; ++, 30-60%; +++,> 60% [0120] As a result of the tests in tables 5 to 7, it was identified that the inhibitory effect of the inflammatory reaction on the macrophage differs, depending on the types of lactic acid bacteria. Particularly, in the case of lactic acid bacteria of Bifidobacterium spp. and from lactic acid bacteria of Lactobacillus spp., it has been identified that an inhibitory effect of the inflammatory reaction differs not only depending on the species, but also depending on the strains, even if these strains are of the same species. Of these strains, in the case of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76, it was identified that a rate of inhibition of NF-kB activation and a rate of inhibition of TNF-α expression are all high at the same time. [0121] Furthermore, in the case of chitosan, inulin and citrus pectin as prebiotics, it has been found that an inhibition rate of NF-kB activation and an inhibition rate of TNF-α expression are excellent compared to other prebiotics. Petition 870190084989, of 08/30/2019, p. 52/95 47/88 (2) Test on the inhibitory effect of the inflammatory reaction of lactic acid bacteria on dendritic cells [0122] Immune cells were isolated from the bone marrow of a C57BL / 6 mouse (male, 20-23 g) using RPMI 1640 containing 10% FBS, 1% antibiotics, 1% glutamax and 0.1% mercaptoethanol and then treated with RBC lysis buffer and then washed. Said cells were divided into each well of a 24-well plate and then treated with GM-CSF and IL-4 in a ratio of 1: 1000 and then cultured. On day 5 of culture, cells were replaced by a new medium and then collected at 8 day culture and then used as dendritic cells. Thereafter, the dendritic cells were plated in a 24-well plate at 0.5><10 6 cells / well, treated with a test material, ie, lactic acid bacteria, as well as with an inflammatory reaction inducer, that is, lipopolysaccharide (LPS) for 90 minutes or 24 hours, and then the supernatant and cells were obtained. At that time, the treatment concentration of lactic acid bacteria was 1 χ 10 4 CFU / ml. In addition, to compare the effects of lactic acid bacteria, several prebiotics were used as test material. [0123] An expression level of IL-10 and IL-12 was measured from said supernatant obtained with an ELISA kit. In addition, the level of expression of p65 (NF-κΒ), p-p65 (NF-kB phosphorus) and β-actin was measured from the cells that were obtained after being treated with the test material for 90 minutes, using the same immunoblotting method as in Example 2. (1) above. The test results of the effect Petition 870190084989, of 08/30/2019, p. 53/95 48/88 inhibitors of the inflammatory reaction of lactic acid bacteria in dendritic cells are shown in tables 8 to 10 below. [Table 81 Test material for treatment of dendritic cells Inhibition rate of NF-κΒ activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression Not treated - - - Bifidobacteríum longum IM51 + + + Bifidobacteríum longum IM52 ++ - - Bifidobacteríum longum IM53 + - - Bifidobacteríum longum IM54 + + + Bifidobacteríum longum IM55 +++ ++ +++ Bifidobacteríum longum IM56 ++ ++ ++ Bifidobacteríum longum IM57 + + + Bifidobacteriumlongum IM58 + + - Bifidobacterium + + - Petition 870190084989, of 08/30/2019, p. 54/95 49/88 Test material for treatment of dendritic cells Inhibition rate of NF-κΒ activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression longum IM59 Bifidobacteriurnlongum IM60 + + - Bifidobacteriurn longum IM61 + + - Bifidobacteriurn longum IM62 + + - Bifidobacteriurn longum IM53 + + - Bifidobacteriurn longum IM64 + + + Bifidobacteriurn longum IM65 + + - Bifidobacteriurn adolescentis IM66 + + + + + - Bifidobacteriurn adolescentis IM67 + + + Bifidobacteriurn adolescentis IM68 + + + Bifidobacteriurn adolescentis IM69 + + - Bifidobacteriurn adolescentis IM70 + + - Petition 870190084989, of 08/30/2019, p. 55/95 50/88 Test material for treatment of dendritic cells Inhibition rate of NF-κΒ activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression Bifídobacterium adolescentis IM71 + + - [Table 9] Test material for treatment of dendritic cells Inhibition rate of NF-κΒ activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression Bifidobacterium adolescentis IM72 + + - Bifidobacterium adolescentis IM73 + + + Bifidobacterium adolescentis IM74 + + + Bifidobacterium adolescentis IM75 + + + Lactobacillus plantarum IM76 + + + + ++ Lactobacillusplantarum IM77 + + + Lactobacillusplantarum IM78 + + + Petition 870190084989, of 08/30/2019, p. 56/95 51/88 Test material for treatment of dendritic cells Inhibition rate of NF-κΒ activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression Lactobacillusplantarum IM7 9 + + - Lactobacillus plantarum IM80 + + + Lactobacillusplantarum IM81 + + + Lactobacillusplantarum IM82 + + - Lactobacillus plantarum IM83 + + + Lactobacillusplantarum IM84 + + + Lactobacillus plantarum IM85 + + + Lactobacillus plantarum IM86 + + - Lactobacillusplantarum IM87 + + + + + Lactobacillusplantarum IM88 + + - Lactobacillus plantarum IM89 + + - Lactobacillus + + + Petition 870190084989, of 08/30/2019, p. 57/95 52/88 Test material for treatment of dendritic cells Inhibition rate of NF-κΒ activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression acidophilus IM90 Lactobacillus acidophilus IM91 + + - Lactobacillus acidophilus IM92 + + - Lactobacillus acidophilus IM93 + + + [Table 1θ] Test material for treatment of dendritic cells Inhibition rate of NF-kB activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression Lactobacillus acidophilus IM94 + + - Lactobacillus acidophilus IM95 + + - Lactobacillus acidophilus IM96 + + - Lactobacillus + + - Petition 870190084989, of 08/30/2019, p. 58/95 53/88 Test material for treatment of dendritic cells Inhibition rate of NF-kB activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression acidophilus IM97 Lactobacillus acidophilus IM98 + + - Lactobacillus acidophilus IM99 + + + Inulin + + + + Citrus pectin + + + + ++ Carragena + + - Trealose + + + Lactulose + + - Cyclodextrin + + - Carboxymethylcellulose + + - Gelatine + + + Chitosan + + + ++ Alginic acid + + + Fructo-oligosaccharides + + - Degreased soy protein + + + Apple pectin + + - Arabinogalactana + + + Petition 870190084989, of 08/30/2019, p. 59/95 54/88 Test material for treatment of dendritic cells Inhibition rate of NF-kB activation (pp65 / p65) Rate of inhibition of IL-12 expression Rate of increase in IL-10 expression Xylan + + + + * Inhibition rate: -, <10%; +, 10-30%; ++, 30-60%; +++,> 60% * Rate of increase: <10%; +, 10-50%; ++, 50-100%; +++,> 100% [0124] As a result of the tests in tables 8 to 10, it was identified that the inhibitory effect of the inflammatory reaction in dendritic cells differs depending on the types of lactic acid bacteria. Particularly, in the case of lactic acid bacteria of Bifidobacterium spp. and from lactic acid bacteria of Lactobacillus spp., it has been identified that an inhibitory effect of the inflammatory reaction differs not only depending on the species, but also depending on the strains, even if these strains are of the same species. In particular, part of the strains showed results in which the expression of IL-12 is increased. On the other hand, most strains showed results in which the expression of IL-10 is reduced. Of these strains, in the case of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76, It was identified what a fee in inhibition gives activation of NF-kB and an rate in inhibition gives expression in IL-12 are the bigger and an rate in increase gives expression of IL-10 It is also The May or, simultaneously. Petition 870190084989, of 08/30/2019, p. 60/95 55/88 [0125] Furthermore, in the case of chitosan, inulin and citrus pectin as prebiotics, it was identified that the rate of inhibition of NF-kB activation, the rate of inhibition of IL-12 expression and the rate of increase the expression of IL-10 are excellent compared to other prebiotics. [0126] From Example 2 above, among the various lactic acid bacteria, Bifidobacterium longum IM55 and Lactobacillus plantarum IM7 6 had the best inhibitory effect on the inflammatory reaction. In addition, from several prebiotics, it was identified that chitosan, inulin, citrus pectin have an excellent inhibitory effect on the inflammatory reaction. Example 3. Evaluation of the regulatory effect of immunity of lactic acid bacteria (1) Rate of cell differentiation [0127] To control, prevent, relieve or treat allergic diseases, particularly those caused by a type 1 hypersensitivity reaction, it is important reduce the production of IgE antibodies and increase the production of regulatory T cells (Treg cells) that release IL-10 due to an immune reaction to an allergen. It is known that an allergic reaction becomes more complicated not only through mediators produced by basophilic mast cells or the like, but also through an action of cytokines secreted by these cells, and a part of the symptoms shown as the allergic reaction results from an action of these cytokines. Cytokines such as TNF-α, IL-4, IL-5, IL-6, IL-13, etc., are produced by mast cells and these cytokines play a role in the clustering of neutrophils and eosinophils. In addition, IL-4 and IL-13 Petition 870190084989, of 08/30/2019, p. 61/95 56/88 secreted by mast cells activate B cells to produce IgE antibodies, and IL-5 plays a role in the clustering and activation of eosinophils. Cytokines such as IL-4 and IL-5 are generally classified into Th2 cytokines, because many of these cytokines are secreted by Th2 cells, and the cytokines secreted by mast cells and Th2 cells bind to their respective receptors and therefore act to induce an interaction between cells and amplify an allergic reaction. In addition, a symptom of allergic shock can occur when TNF-α, a representative proinflammatory cytokine, is produced systemically in quantity in an allergic state. [0128] Thus, in order to assess a regulatory effect on the immunity of lactic acid bacteria isolated from excrement or kimchi cabbage, an influence of lactic acid bacteria on the immune reactions of spleen cells was measured by measuring a rate of inhibition of differentiation in secretory cells of said cytokines and an increased rate of differentiation in Treg cells. [0129] In particular, a spleen was isolated from a C56BL / 6J mouse, then ground and suspended in RPMI 1640 medium containing 10% FCS, and then CD4 T cells were isolated using a CD4 T cell isolation kit (MiltenyiBiotec, Bergisch Gladbach, Germany) The isolated CD4 T cells were divided into a 12 well plate at 5χ10 5 cells per well. After that, cells were cultured in each well with the addition of anti-CD3, anti-CD28, IL-2 and IL-12 to induce differentiation of T cells into Th1 cells; with the addition of anti-CD3, antiCD28, IL-2 and IL-4 to induce T cell differentiation Petition 870190084989, of 08/30/2019, p. 62/95 57/88 in Th2 cells; with the addition of anti-CD3, anti-CD28, IL-6 and TGF-β, to induce differentiation of T cells into Th17 cells; and with the addition of anti-CD3 and anti-CD28 to induce differentiation of T cells into Treg cells, and a test material, that is, lactic acid bacteria were inserted into the wells at 1 x 10 5 CFU per well and then grown for four days. In addition, to compare the effects of lactic acid bacteria, several prebiotics were used as test material. [0130] After that, the differentiation potency of T cells isolated from the spleen in Thl, Th2, Thl7 and Treg cells was measured. In particular, the cells of the culture fluid were stained with anti-FOXp3 or antiIL-17A antibodies and then the distribution of Thl, Th2, Thl7 and Treg cells was analyzed using a FACS (fluorescence-activated cell sorting) device [ fluorescence activated cell separation]) (C6 Flow Cytometer® System, San Jose, CA, USA), the results of which are shown in tables 11 to 13. In tables 11 to 13 below, the lactic acid bacteria are shown without the species names and are referred to by the names of strains assigned by the present inventors. [Table 111 Test material for treatment of spleen T cells Differentiation inhibition rate Differentiation increase rate CellsThl CellsTh2 CellsThl7 Treg Cells Not treated - - - - Petition 870190084989, of 08/30/2019, p. 63/95 58/88 Test material for treatment of spleen T cells Differentiation inhibition rate Differentiation increase rate CellsThl CellsTh2 CellsThl7 Cells Treg IM51 + + + + IM52 + + - - - IM53 + - + + IM54 + + + + IM55 + + + +++ +++ +++ IM5 6 + + + + + IM57 + + - + + IM58 + + - + - IM59 + + + - IM60 + + + - IM61 + + + ++ + IM62 + + + ++ + IM63 + + + + IM64 + + ++ + + IM65 + + + + IM66 + + + + ++ + IM67 + + + ++ + IM68 + + + ++ + IM69 + + + + IM7 0 + + + ++ + IM71 + + + ++ + Petition 870190084989, of 08/30/2019, p. 64/95 59/88 [Table 12] Material of Rate of inhibition gives Rate of increase test for differentiationgives treatment of differentiation T cells of Cells Cells Cells Treg Cells spleen Thl Th2 Thl7 IM72 + + + + IM7 3 + + + + + IM7 4 + + + + IM7 5 + + + + + + + IM7 6 + + + + + + + + + + + IM7 7 + + + + IM7 8 + + + + + + IM7 9 + + + + + IM8 0 + + + + + IM81 + + + + + IM82 + + + + IM83 + + + + + + IM84 + + + + + IM85 + + + + IM8 6 + + + + IM87 + + + + + IM8 8 + + + + IM8 9 + + + + + + IM90 + + + + IM91 + + + + Petition 870190084989, of 08/30/2019, p. 65/95 60/88 Test material for treatment of spleen T cells Differentiation inhibition rate Differentiation increase rate CellsThl CellsTh2 CellsThl7 Treg Cells IM92 + + + + IM93 + + + + + + [Table 13] Test material for treatment of spleen T cells Differentiation inhibition rate Differentiation increase rate CellsThl CellsTh2 CellsThl7 Cells Treg IM94 + + + + IM95 + + + + IM96 + + + + + + + IM97 + + + + IM98 + + + - IM99 + + + + PI + + + + P2 + + + + + + ++ P3 + + + + + + + P4 + + + + P5 + + + - ++ P6 + + + ++ + Petition 870190084989, of 08/30/2019, p. 66/95 61/88 Test material for treatment of spleen T cells Differentiation inhibition rate Differentiation increase rate CellsThl CellsTh2 CellsThl7 Cells Treg P7 + + + + + + - P8 + + + + + P9 + + + + + P10 + + + + + Pll + + + ++ P12 + + + + P13 + + + - P14 + + + - P15 + + + + + - * Inhibition rate: -, <10%; +, 10-30%; ++, 30-60%; +++,> 60% * Rate of increase: -, <10%; +, 10-50%; ++, 50-100%; +++,> 100% * Pl: inulin; P2: citrus pectin: P3: carrageenan; P4: trehalose; P5: lactulose; P6: cyclodextrin; P7: carboxymethyl cellulose; P8: gelatin; P9: chitosan; P10: alginic acid; Pll: fructo-oligosaccharide; P12: defatted soy protein; P13: apple pectin; P14: arabinogalactan; and P15: xylan [0131] As a result of the experiments in tables 11 to 13, it was identified that a differentiation rate of T cells differs depending on the types of lactic acid bacteria. Particularly, in the case of acidic bacteria Petition 870190084989, of 08/30/2019, p. 67/95 62/88 lactic acid Bifidobacterium spp., The rate of inhibition of differentiation in Thl, Th2 and Thl7 cells and the rate of increase in differentiation in Treg cells differs according to the types of lactic acid bacteria, and a part of the acid- lactic acid showed results in which an inhibition rate of Th2 cells and an increase rate of Treg cells are the opposite of those of other lactic acid bacteria. Of these lactic acid bacteria, it was identified for Bifidobacterium longum IM55 that the rate of inhibition of differentiation in Thl, Th2 and Thl7 cells is the highest and an increase rate of differentiation in Treg cells is also the highest, simultaneously. In addition, lactic acid bacteria Lactobacillus spp. presented results similar to the lactic acid bacteria Bifidobacterium spp., in which the rates of inhibition and increased cell differentiation depend on the types of lactic acid bacteria. Of these lactic acid bacteria, it was identified for Lactobacillus plantarum IM7 6 that the rate of inhibition of differentiation in Thl, Th2 and Thl7 cells and the rate of increase in differentiation in Treg cells are the highest. (2) Rate of cytokine expression [0132] In addition, an expression rate of transcription factors and cytokines from Thl, Th2, Thl7 and Treg cells differentiated from spleen T cells was measured. In particular, expression levels were analyzed respectively by qRT-PCR for T-bet, ΙΕΝ-γ and IL-12 from culture fluid, to induce differentiation of Thl cells; GATA3 and IL-5 from the culture fluid to induce differentiation of Th2 cells; RORyt and IL-17 from culture fluid to induce cell differentiation Petition 870190084989, of 08/30/2019, p. 68/95 63/88 Thl7; and Foxp3 and IL-10 from the culture fluid to induce differentiation of Treg cells. The following table 14 shows the results in such a way that a primer sequence used for qRT-PCR corresponds to that of an amplification target. In addition, the results of measuring the rates of expression of transcription factors and cytokines from Thl, Th2, Thl7 and Treg cells differentiated from spleen T cells are shown in tables 15 and 16. In tables 15 to 16 below, the bacteria lactic acid are shown without the species names and are named after the names of strains assigned by the present inventors. [Table 14] Target ofamplification Initiator type Initiator string T-bet Direct (SEQID NO: 3) 5'-CCTCTTCTATCCAACCAGTATC-3 ' Reverse (SEQID NO: 4) 5'-CTCCGCTTCATAACTGTGT-3 ' IFN-γ Direct (SEQID NO: 5) 5'-TCAAGTGGCATAGATGTGGAAGAA-3 ' Reverse (SEQID NO: 6) 5'-TGGCTCTGCAGGATTTTCATG-3 ’ GATA3 Direct (SEQID NO: 7) 5'-GAAGGCATCCAGACCCGAAAC-3 ’ Reverse (SEQID NO: 8) 5'-ACCCATGGCGGTGACCATGC-3 ' IL-5 Direct (SEQID NO: 9) 5'-AAAGAGAAGTGTGGCGAGGAGAGAC-3 ' Petition 870190084989, of 08/30/2019, p. 69/95 64/88 Target ofamplification Initiator type Initiator stringReverse (SEQID NO: 10) 5 '-CCTTCCATTGCCCACTCTGTACTCATC-3 ' RORvt Direct (SEQID NO: 11) 5'-ACAGCCACTGCATTCCCAGTTT-3 ' Reverse (SEQID NO: 12) 5'-TCTCGGAAGGACTTGCAGACAT-3 ' IL-17 Direct (SEQID NO: 13) 5'-TTTAACTCCCTTGGCGCAAAA-3 ’ Reverse (SEQID NO: 14) 5'-CTTTCCCTCCGCATTGACAC-3 ' FOXp3 Direct (SEQID NO: 15) 5'-CCCATCCCCAGGAGTCTT-3 ' Reverse (SEQID NO: 16) 5'-ACCATGACTAGGGGCACTGTA-3 ’ IL-10 Direct (SEQID NO: 17) 5'- ATGCTGCCTGCTCTTACTGACTG-3 ' Reverse (SEQID NO: 18) 5'- CCCAAGTAACCCTTAAAGTCCTGC-3 ’ GAPDH Direct (SEQID NO: 19) 5'-TGCAGTGGCAAAGTGGAGAT-3 ' Reverse (SEQID NO: 20) 5'-TTTGCCGTGAGTGGAGTCAT-3 ' Petition 870190084989, of 08/30/2019, p. 70/95 65/88 [Table 15] Test material for treatment of spleen T cells Expression inhibition rate Rate of expression increase T-bet IFN-Y GATA3 IL-5 RORvt IL-17 FOXp3 IL-10 Not treated - - - - - - - - IM51 + ++ + + + + + + IM52 ++ + - + - + - - IM53 + + - + + ++ + - IM54 + + + ++ + + ++ + IM55 +++ + +++ +++ +++ +++ +++ +++ IM5 6 ++ + + ++ + ++ + ++ IM57 ++ ++ - + + + + + IM58 ++ ++ - ++ + + - - IM59 + + + + + + - + IM60 + ++ + ++ + + - - IM61 ++ + + ++ ++ ++ + - IM62 ++ + + ++ ++ ++ + + IM63 + ++ + + + + + - IM64 ++ + ++ ++ + + + + IM65 + + + + + + + - IM66 ++ + + + ++ ++ + + IM67 + + + + ++ + + + IM68 ++ ++ + + ++ ++ + + IM69 + + + + + + + - Petition 870190084989, of 08/30/2019, p. 71/95 66/88 Test material for treatment of spleen T cells Expression inhibition rate Rate of expression increase T-bet IFN-Y GATA3 IL-5 RORyt IL-17 FOXp3 IL-10 IM7 0 + + + + + + + + + + + IM71 + + + + + + + + + + + IM72 + + + + + + + + + IM7 3 + + + + + + + + + IM7 4 + + + + + + + + [Table 16] Test material for treatment of spleen T cells Expression inhibition rate Rate of expression increase T-bet IFN-Y GATA3 IL-5 RORyt IL-17 FOXp3 IL-10 IM7 5 + + + + + + + + + + IM7 6 + + + + + + + + + + + + + + + + + + + + + + IM7 7 + + + + + + + + + IM7 8 + + + + + + + + + + + IM7 9 + + + + + + + + + + - IM8 0 + + + + + + + + + IM81 + + + + + + + + + + IM82 + + + + + + + + IM83 + + + + + + + + + + + + + Petition 870190084989, of 08/30/2019, p. 72/95 67/88 Test material for treatment of spleen T cells Expression inhibition rate Rate of expression increase T-bet IFN-Y GATA3 IL-5 RORvt IL-17 FOXp3 IL-10 IM84 + + + + + + + + + + IM85 + + + + + + + + + + IM8 6 + + + + + + + - IM87 + + + + + + + + + + IM8 8 + + + + + + + + + - IM8 9 + + + + + + + + + - IM90 + + + + + + + + + IM91 + + + + + + + + - IM92 + + + + + + + - IM93 + + + + + + + + + + + IM94 + + + + + + + + IM95 + + + + + + + - IM96 + + + + + + + + + + + + - IM97 + + + + + + + + IM98 + + + + + + - - IM99 + + + + + + + + * Fee in inhibition: <10%; +, 10-30 %; ++, 30-60% ; +++, > 60%* Fee in increase: <10%; +, 10-50 %; ++, 50-100% ; +++, > 100%[0133]As a result of measurements in tables 15 and 16, it was identified that a rate of change in the expression of Petition 870190084989, of 08/30/2019, p. 73/95 68/88 cytokine differs depending From types in bacteria acid- lactic. Particularly, at the case in bacteria acid- lactic Bifidobacterium spp., an part of the bacteria lactic acid showed results in which a rate of inhibition of GATA3 and IL-5 expression is the opposite of that of other lactic acid bacteria. Of these lactic acid bacteria, it was identified for Bifidobacterium longum IM55 that a rate of inhibition of the expression of T-bet, IFN-γ, GATA3, IL-5, RORyt and IL-17 is the highest and an increase rate of expression of FOXp3 and IL-10 is also the largest, simultaneously. Furthermore, in the case of acid-lactic bacteria Lactobacillus spp., Some of the acid-lactic bacteria show similar results to those of the lactic acid bacteria Bifidobacterium spp., In which the rate of change in the expression of cytokines also differs. Of these lactic acid bacteria, it was identified for Lactobacillus plantarum IM76 that a rate of inhibition of the expression of T-bet, IFN-γ, GATA3, IL-5, RORyt and IL-17 is the highest and an increase rate of expression of FOXp3 and IL-10 is also higher, simultaneously. Example 4. Test on the inhibitory effect of the inflammatory reaction of IM55 and IM76 [0134] Among the isolated lactic acid bacteria in Example 1 above, a test was performed on the inhibitory effect of the inflammatory reaction of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76. (1) Test on the inhibitory effect of the inflammatory reaction of IM55 and IM76 on macrophages [0135] A seven-week-old female BALB / c mouse (20-22 g) was purchased from Raonbio Co., Ltd., and Petition 870190084989, of 08/30/2019, p. 74/95 69/88 acclimatized for seven days before an experiment. 2 ml of sterile 4% thioglycolate was administered intraperitoneally to the mouse, which was then sacrificed 96 hours later. The fluids from the peritoneal cavity were collected with 10 ml of RPMI 1640 and then centrifuged at 300 xg for 10 minutes and then washed with RPMI 1640. The cells were plated on a 12-well microplate at 0.5 χ 10 6 cells per well and then cultured in RPMI 1640 medium containing 1% antibiotic-antimycotic and 10% FBS at 37 ° C for 20 hours and then washed three times. Bound cells were used as macrophages. To measure an effect of IM55 or IM7 6 on cytokine expression, macrophages at 1 * 10 6 cells / well were treated with lactic acid bacteria at 1 x 10 5 CFU / ml, as well as an inducer of inflammatory reaction, that is, LPS for 20 hours. An expression level of each cytokine was measured using the same ELISA kit as in Example 2. (1) above. As a result of the measurement, it was identified that an expression of IL-10 is increased and an expression of IL-12 is inhibited after administration of IM55 or IM76 (Figs. 1 and 2). (2) Test on the inhibitory effect of the inflammatory reaction of IM55 and IM76 in dendritic cells [0136] Mouse bone marrow cells were collected from a seven-week-old female BALB / c mouse (20-22 g) with RPMI 1640 according to a known method (Immunopharmacol. Immunotoxicol., 2016, 38, 447454). 2 x 10 6 collected cells were seeded in a 12-well plate and cultured in RPMI 1640 medium containing 20 ng / ml rGM-CSF, 10% FBS, 1% antibiotic-antimycotic and Petition 870190084989, of 08/30/2019, p. 75/95 70/88 150 pg / ml gentamicin. [0137] To measure a IM55 and IM76 effect on the expression of cytokines, said cells were replaced by conditioned medium 3 and 6 days of culture to remove granulocytes and then treated with lactic acid bacteria 1 χ 10 5 cfu / ml LPS and 100 ng / ml on day 8 of culture. An expression level of each cytokine was measured using the same ELISA kit as in Example 2. (2) above. As a result of the measurement, it was identified that an expression of IL-10 is increased and an expression of TNF-α is inhibited after administration of IM55 or IM76 (Figs. 3 and 4). [0138] From the results of Example 4 above, it can be seen that innovative lactic acid bacteria, that is, Bifidobacterium longum IM55 and Lactobacillus plantarum IM76, have an excellent inhibitory effect on the inflammatory reaction and, therefore, have an excellent effect on prevent, mitigate and treat inflammatory diseases. Example 5. Evaluation of the regulatory effect of the immunity of IM55 and IM76 [0139] A rate of T cell differentiation was analyzed by a method similar to that of Example 3 above, in order to evaluate the regulatory effect of the immunity of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 of these lactic acid bacteria isolated from Example 1 above [0140] Particularly, in a sterile manner, the spleen of a seven-week-old female BALB / c mouse (20-22 g) was isolated, then it was ground properly and then treated with tri-buffered ammonium chloride. The resulting cells were suspended in an RPMI 1640 medium containing 10% FCS, after which the cells Petition 870190084989, of 08/30/2019, p. 76/95 71/88 T cells were isolated from a cell suspension using the Pan T Cell Isolation Kit II T cell isolation kit. The cells were cultured, respectively, with an addition of anti-CD28 (1 pg / ml), anti-CD3 (1 pg / ml), rIL-4 (10 pg / ml) and rIL-2 (10 pg / ml) to induce differentiation of isolated T cells (1 * 10 5 cells / well) into Th2 cells; and with the addition of anti-CD28 (1 pg / ml) and anti-CD3 (1 pg / ml) to induce the differentiation of T cells (1 χ 10 5 cells / well) into Treg cells, and the cells were also, respectively, grown for four days with the addition of IM55 or IM7 6 at 1 * 10 5 CFU / ml per well. The RNA of these cells was isolated and after that an expression level of IL-10, GATA3, FOXp3 and IL-5 was analyzed using qRT-PCR. The same qRT-PCR was performed as in Example 3 above and using the same primer, as shown in table 14 above. [0141] As a result of the analysis, it was identified, for treatment with IM55 or IM 7 6, that a level of GATA3 and IL-5 expression is reduced to inhibit differentiation in Th2 cells (Figs. 5 and 6), while that an expression level of FOXp3 and IL-10 is increased to promote differentiation in Treg cells (Figs. 7 and 8). [0142] From the results of Example 5 above, it can be seen that the innovative lactic acid bacteria, that is, Bifidobacterium longum IM55 and Lactobacillus plantarum IM76, have an excellent immunity regulating effect and therefore have an excellent effect in preventing , mitigate and treat immune diseases. Example 6. Evaluation of the relief effect of lactic acid bacteria on rhinitis and asthma (1) Petition 870190084989, of 08/30/2019, p. 77/95 72/88 [0143] Bronchoalveolar lavage (BAL), which is performed in conjunction with bronchial endoscopy, has been widely used to collect cells and other soluble components of an epithelial mucous layer that covers the airways and pulmonary alveoli. Bronchoalveolar lavage fluid (FLBA) includes not only different proteins in a blood stream, but also proteins secreted by different types of cells, including epithelial cells and inflammatory cells. FLBA is generally used to diagnose bronchial asthma, bronchitis or lung disease, or to analyze their pathological conditions. Thus, in order to identify a relief effect for rhinitis and asthma, indicators related to antirinitis and antiasthma effects were analyzed from serum and lung tissues, as well as from FLBA. (1) Experimental method [0144] Seven-week-old female BALB / c mice (21-23 g) were acclimated for one week in a controlled environment with 50% humidity, temperature of 25 ° C and a light / dark cycle of 12 :12 hours. Thereafter, 20 pg of allergy-inducing ovalbumin (OVA) and 2 mg of aluminum hydroxide (Alum) were suspended in 0.2 ml of phosphate buffered saline (PBS: pH 7.4) and injected intraperitoneally into each of the mice on the first day and on the 14th day of the experiment. Then, 100 pg of OVA were dissolved in 10 pl of distilled water and applied intranasally to each of the mice to induce allergic rhinitis and asthma on the 26th, 27th and 28th days of the experiment. In the meantime, an experimental drug, that is, acid-lactic bacteria were administered orally in each Petition 870190084989, of 08/30/2019, p. 78/95 73/88 of the mice once a day, for a total of five days, from the 26th to the 30th day of the experiment. In addition, dexamethasone, which was used as a positive control drug instead of lactic acid bacteria, was administered intraperitoneally at a dose of 1 mg / kg bw. In addition, in the case of normal group mice, they were not induced to allergic rhinitis and asthma, but only phosphate-buffered saline (PBS: pH 7.4) was administered orally to these mice, instead of OVA and the experimental drug. In addition, in the case of the mice in the control group, allergic rhinitis and asthma were induced in these and only phosphate buffered saline (PBS: pH 7.4) was administered orally as an experimental drug. After the end of the experiment, the mice were anesthetized and blood, lung tissue and FLBA were collected. The serum was isolated from the blood collected by centrifugation and used as a test sample. [0145] Indicators related to anti-rhinitis and anti-asthma effects were analyzed from serum, FLBA and lung tissue using various methods of analysis. Each analysis method and the indicators analyzed are indicated below. * ELISA (Enzyme-linked immunosorbent assay): IL-10, IL-5, IL-6, IL-4, IgE, etc. * FACS (Fluorescence activated cell separation): T cell distribution (Thl: CD4 + / IFN-y + ; Th2: CD4 + / IL- + ; Treg: CD4 + / FOXp3 + ; Thl7: CD4 + / IL-17 + ), Distribution of eosinophils (CDllb + , Siglec-F + ) (2) Experimental results Petition 870190084989, of 08/30/2019, p. 79/95 74/88 [0146] As a result of the experiment, it was identified that the expression of IL-5, IL-4 and IgE, that is, the indicators related to rhinitis and asthma, is notably inhibited in the serum of a group treated with IM55 or IM76 (Table 17 and Figs. 9 to 11). In addition, it was identified that an amount of IL-5 and IL-4, that is, the indicators related to rhinitis and asthma, is notably decreased and a proportion of Th2 cells and eosinophils is also notably decreased in the FBA (Table 18 and Figures 12 to 15). In addition, it has been identified that an IL-10 expression, related to a prevention and treatment effect of rhinitis and asthma, is increased and a proportion of Treg cells is increased in the FLBA (Table 18 and Figs. 16 and 17). [Table 17] Classification of experimental groups Inhibition rate IL-5 IgE IL-4 Con - - - IM55 +++ ++ +++ IM7 6 ++ + ++ Dx ++ +++ +++ Petition 870190084989, of 08/30/2019, p. 80/95 75/88 [Table 18] Classification of experimental groups Inhibition rate Rate of increase IL-5 IL-4 CellsTh2 Eosinophils IL-10 CellsTreg Con - - - - - - IM55 +++ +++ ++ +++ +++ +++ IM7 6 ++ +++ +++ +++ +++ + Dx +++ +++ +++ +++ ++ - * Inhibition rate: <10%; +, 10-30%; ++, 30-60%; +++,> 60% * Rate of increase: <10%; +, 10-50%; ++, 50-100%; +++,> 100% Example 7. Evaluation of the relief effect of lactic acid bacteria on rhinitis and asthma (2) (1) Experimental method [0147] OVA-induced allergic rhinitis models were prepared with reference to a known method (Oh et al., Immunopharmacol. Immunotoxicol., 2013, 35, 678-686) Particularly, the mice were randomly divided into six groups (n = 8 per group). For five groups, the OVA (20 .mu.g) diluted in potassium aluminum sulfate solution was injected intraperitoneally in mice in the I and day 14 of the experiment. 100 pg of OVA were dissolved in 10 pl of distilled water and applied intranasally to each of these mice to induce allergic rhinitis and asthma from the 26th, 27th and 28th days of the experiment. Meanwhile, an experimental material (IM55 (ΙχΙΟ 9 UFC / mouse), IM7 6 (ΙχΙΟ 9 UFC / mouse), Petition 870190084989, of 08/30/2019, p. 81/95 76/88 dexamethasone (1 mg / kg) or saline) was administered to the mice once a day for a total of five days, from the 26th to the 30th day of the experiment. In the case of mice in a normal group, allergic rhinitis and asthma were not induced, only the saline solution administered to them. The mice were subjected to irritation by intranasal administration of OVA (10 μΐ / nostril, dissolved in 10 mg / ml of saline) in both nasal cavities, after which the number of sneezes and nasal friction behavior (score of rhinitis symptoms) was counted for 10 minutes on the 31st day of the experiment. [0148] Lung and nasal cavity tissues were isolated for biopsy and then fixed with 4% neutral buffered formalin and then frozen. Using a cryostat, said frozen tissues were cut into cross sections of 10 pm and stained with hematoxylin and eosin (H&E) and reacted with periodic acid Schiff staining (PAS). [0149] In addition, indicators related to the anti-rhinitis and antiasthma effects of the nasal cavity, serum, FLBA and lung tissue were analyzed using various methods of analysis from Example 3 above, etc. Particularly the indicators of the nasal cavity and serum were measured with an ELISA kit and the indicators related to rhinitis and asthma from the FLBA and lung tissue were measured with qRT-PCR using the primers in table 14 above. (2) Experimental results [0150] When the mice were treated with OVA, a score of rhinitis symptoms (number of sneezes and Petition 870190084989, of 08/30/2019, p. 82/95 77/88 nasal friction behaviors) and symptoms of allergic rhinitis, including the expression of IL-4 and IL-5 in the nasal cavity were significantly increased. However, upon treatment with IM55 or IM76, a level of symptoms of allergic rhinitis and IL-4 and IL-5 in the nasal cavity caused by OVA was significantly reduced (Figs. 18 to 20). In addition, in the case of treatment with IM55 or IM7 6, a disorder of the nasal cavity caused by OVA was relieved and an expansion of epithelial cells in the nasal cavity was relieved (Fig. 21). [0151] In addition, as a result of the histological examination, in the case of an animal model with induced rhinitis, pulmonary inflammation and edema were also induced; an expression of IL-5 and GATA3 was increased; and an expression of IL-10 and FOXp3 was reduced. However, upon treatment with IM55 or IM76, a lung tissue disorder and an expansion of epithelial cells caused by OVA were inhibited; an expression of GATA3 and IL-5 was inhibited; and an expression of FOXp3 and IL-10 was increased (Figs. 22 to 26). Example 8. Evaluation of the relief effect of mixed lactic acid bacteria on rhinitis and asthma (3) [0152] An evaluation was performed for a separate effect of IM55 or IM7 6 and also for an effect of mixtures of IM55 and IM7 6 in relieving rhinitis and asthma. In particular, a rhinitis symptom score, a distribution rate (%) of eosinophils in the FLBA and a level of cytokine expression in the blood were analyzed using the same method used in Example 3 above, etc. [0153] As a result, it was identified, for a group Petition 870190084989, of 08/30/2019, p. 83/95 78/88 treated with a mixture of IM55 and IM76 in a ratio of 1: 1, 1: 3 and 1: 9, that an inflammatory symptom score verified by the number of sneezes and nasal friction behaviors, is reduced and a level of IL-5 expression in the nasal cavity is reduced (Fig. 27). In addition, it has been found that a level of IL-5 expression in the serum is reduced (Fig. 28). [0154] From the experiment on a model with rhinitis induced in Examples 6 to 8 above, it can be seen that a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 has an effect of preventing, alleviating and treating asthma and rhinitis. Example 9. Effect of normalization of intestinal microorganisms and relief of colitis [0155] Intestinal microorganisms, which have recently been reported to have an influence on the occurrence and aggravation of allergic diseases, are an important factor in the occurrence of allergic diseases. Thus, in order to identify a change in the microorganisms in the colon, according to the administration of the innovative lactic acid bacteria, an expression of cytokines and a change in the intestinal microorganisms of the colon were analyzed in relation to an allergic rhinitis model of Example 7 above. [0156] In particular, 2 pg of RNA was isolated from colon tissues of said animal model using a Takara thermal cycler and a SYBR premix. QPCR was performed with said RNA and a primer used for qPCR was the same as shown in table 14 above. [0157] As a result of the analysis, an expression of IL-4 and IL-5 was increased and an expression of IL-10 was reduced Petition 870190084989, of 08/30/2019, p. 84/95 79/88 in the colon with OVA treatment. However, with treatment with IM55, IM7 6 or mixtures thereof, it was identified that the expression of IL-4 and IL-5 is reduced and an expression of IL-10 is increased (Fig. 29). [0158] Furthermore, after isolating the colon from said animal model, 100 ng of total DNA was isolated from the colon fluid of said animal model using a Takara thermal cycler and a SYBR premix. QPCR was performed with said DNA and a primer used for qPCR was the same as shown in the following table 19. [Table 19] Kind of Kind of Initiator string bacterium initiator (5’-3 ’) Firmicutes Direct (SEQID NO: 21) GGAGYATGTGGTTTAATTCGAAGCAReverse (SEQID NO: 22) AGCTGACGACAACCATGCAC Bacteroidetes Direct (SEQID NO: 23) AAC G C GAAAAAC C Τ TAC C TAC CReverse (SEQID NO: 24) TGCCCTTTCGTAGCAACTAGTG Actinobacteria Direct (SEQID NO: 25) TGTAGCGGTGGAATGCGCReverse (SEQID NO: 26) AATTAAGCCACATGCTCCGCT δ / γ-proteobacteria Direct (SEQID NO: 27) GCTAACGCATTAAGTRYCCCG Reverse (SEQ GCCATGCRGCACCTGTCT Petition 870190084989, of 08/30/2019, p. 85/95 80/88 Type of bacteria Initiator type Initiator string(5’-3 ’)ID NO: 28)TM7 Direct (SEQID NO: 29) GCAACTCTTTACGCCCAGT Reverse (SEQID NO: 30) GAGAGGAT GAT CAGCCAG [0159] As a result of the analysis, with OVA treatment, a population of Firmicutes, Proteobacteria and TM7 was increased and a population of Bacteroidetes and Actinobacteria was reduced and, therefore, a proportion of Firmicutes / Bacteroides (F / B) and Proteobacteria / Bacteroidetes (B / W) has been increased. However, with treatment with IM55, IM76 or mixtures thereof, it was identified that a group of Proteobacteria increased by OVA is significantly inhibited and a group of Bacteroidetes and Actinobacteria reduced by the occurrence of rhinitis is recovered (Fig. 30). [0160] From the results, it can be seen that IM55, IM7 6 and mixtures of them not only normalize altered intestinal microorganisms, but also have an effect of controlling, preventing, relieving and treating colitis Example 10. Preparation for pharmaceutical compositions containing lactic acid bacteria, etc. [0161] In preparation for the following pharmaceutical compositions, the culture product of Bifidobacterium longum IM55 can be replaced by a strain of Bifidobacterium longum IM55 itself, a crushed product of the same or an extract thereof. Furthermore, in Petition 870190084989, of 08/30/2019, p. 86/95 81/88 preparation for the following pharmaceutical compositions, the culture product of Bifidobacterium longum IM55 can be replaced with a strain of Lactobacillus plantarum IM76 itself, a crushed product of the same or an extract thereof. In addition, the following pharmaceutical composition may also contain chitosan. <10-1> Preparation for powder mg of Bifidobacterium longum culture product IM55 100 mg lactose mg talc Said components were mixed and placed in an airtight package to prepare the powder. <10-2> Preparation for mg tablets of Bifidobacterium longum culture product IM55 100 mg of corn starch 100 mg lactose mg magnesium stearate [0162] Said components were mixed and compressed to prepare a tablet, according to a conventional method for preparing tablets. <10-3> Preparation for preparation in Bifidobacterium longum culture product mg capsule IM55 mg crystalline cellulose mg lactose 0.2 mg of magnesium stearate [0163] Said components were mixed and placed in a gelatin capsule to prepare a preparation in Petition 870190084989, of 08/30/2019, p. 87/95 82/88 capsule according to a conventional method for preparing capsule preparations. <10-4> Preparation for Bifidobacterium longum culture product mg pills IM55 150 mg lactose 100 mg glycerin mg xylitol [0164] The said components were mixed and prepared in pill form, each with 4 g, according to a conventional method. <10-5> Preparation for mg granules of Bifidobacterium longum culture product IM55 mg of soy extract 200 mg of glucose 600 mg of starch [0165] The said components were mixed and then 100 mg of 30% ethanol was added and the mixture was oven dried at 60 ° C and then transformed into granules and then packed in a set (pack). <10-6> Preparation for injection mg of Bifidobacterium longum culture product IM55 3.0 mg of sodium metabisulfite 0.8 mg of methylparaben 0.1 mg of propylparaben [0166] Adequate amount of sterile distilled water for injection [0167] These components were mixed and, in Petition 870190084989, of 08/30/2019, p. 88/95 83/88 then 2 ml of the mixture was placed in an ampoule, sterilized and prepared as an injection. Example 11. Preparation for functional health foods containing lactic acid bacteria, etc. [0168] In preparation for the following functional foods for health, a culture product of Bifidobacterium longum IM55 can be replaced by a strain of Bifidobacterium longum IM55 itself, a shredded product or an extract thereof. In addition, in preparation for the following functional foods for health, the culture product of Bifidobacterium longum IM55 can be replaced with a strain of Lactobacillus plantarum IM76 itself, a shredded product or an extract thereof. In addition, the following functional foods for health may still contain chitosan. <11-1> Preparation for a meal in flour [0169] 0.5 part by weight of crop product Bifidobacterium longum IM55 was added in 100 parts by weight of flour and the resulting mixture was used to prepare bread, cake, biscuits, crackers and pasta. <ll-2> Dairy preparation [0170] 0.5 part by weight of culture product Bifidobacterium longum IM55 was added in 100 parts by weight of milk and the said milk was used to prepare various dairy products, such as butter and ice cream. <ll-3> Preparation for grain mixing powder [0171] Unpolished rice, barley, glutinous rice and adlay cereal, which were pre-gelatinized and dried by a known method, were roasted and then prepared in a Petition 870190084989, of 08/30/2019, p. 89/95 84/88 60 mesh particle size powder with a mill. [0172] Black beans, black sesame and perila seed, which were steamed and dried by a known method, were also roasted and then made into a 60 mesh particle size powder with a mill. [0173] Said prepared grains, seeds and nuts and the culture product of Bifidobacterium longum IM55 were formulated in the following proportion to prepare a powder of grain mixture. [0174] Grains (30 parts by weight of unpolished rice, 17 parts by weight of adlay cereal and 20 parts by weight of barley); [0175] Seeds and nuts (7 parts by weight of perilla seeds, 8 parts by weight of black beans and 7 parts by weight of black sesame); [0176] Culture product of Bifidobacterium longum IM55 (1 part by weight); [0177] Ganoderma lucidum (0.5 parts by weight); and [0178] Rehmannia glutinosa (0.5 parts by weight) <ll-4> Preparation for healthy drink [0179] Minor ingredients such as high fructose corn syrup (0.5 g), oligosaccharides (4 g), sugar (2 g), table salt (0.5 g) and water (77 g), as well as 1 g of Bifidobacterium longum culture product IM55 were homogeneously formulated and then pasteurized and packaged in each of small packages like glass bottle, PET bottle, etc., to prepare the healthy drink. <ll-5> Preparation for vegetable juices [0180] 2 g of Bifidobacterium culture product Petition 870190084989, of 08/30/2019, p. 90/95 85/88 longum IM55 was added in 1,000 ml of tomato or carrot juice to prepare vegetable juices. <ll-6> Preparation for fruit juice [0181] 1 g of Bifidobacterium longum IM55 culture product was added in 1,000 ml of apple or grape juice to prepare fruit juice. 6. Registration information for lactic acid bacteria [0182] The present inventors deposited the strain Bifidobacterium longum IM55 for patent purposes at the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Hongjenae, 45, 2 ga-gil, Seodaemun-gu, Seoul, South Korea), January 20, 2017 and received the access number KCCM11961P. In addition, the present inventors deposited the Lactobacillus plantarum IM76 strain for patent purposes at the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Hongjenae, 45, 2 ga-gil, Seodaemun-gu, Seoul, South Korea ), January 20, 2017 and received access number KCCM11962P. The deposit of said lactic acid bacteria was carried out in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of Patent Procedures. [0183] As shown above, the present invention has been described through the Examples above, but is not necessarily limited by them and can be modified in various ways without departing from the scope and spirit of the present invention. Thus, the scope of protection of the present invention must be interpreted so as to include all modalities belonging to the scope of the Petition 870190084989, of 08/30/2019, p. 91/95 86/88 claims attached to the present invention. Petition 870190084989, of 08/30/2019, p. 92/95 87/88 BUDAPEST TREATY ON RECOGNITION INTERNATIONAL DEPOSIT OF MICRO-ORGANISMS FOR THE PURPOSE OF PATENT PROCEDURE INTERNATIONAL FORM To: KIM DONG-HYUN 92-24, Seonjam-Ro, Seonbuk-gu, Seoul,KOREA RECEIPT IN CASE OF AN ORIGINAL issued in accordance with Regulation 7.1 by the DEPOSITORY AUTHORITYINTERNATIONAL identified at the end of this page I. IDENTIFICATION OF MICRO-ORGANISM Identification reference provided byDEPOSIT ANTE:Bifidobacterium longum IM55 Registration number provided by the DEPOSITORY AUTHORITYINTERNATIONAL:KCCM11961P II. SCIENTIFIC DESCRIPTION AND / OR PROPOSED TAXONOMIC DESIGNATION The microorganism identified in I above was accompanied by:□ a scientific description□ a proposed taxonomic designation(Check with a cross where applicable) III. RECEIPT AND ACCEPTANCE This International Depositary Authority accepts the microorganism identified in I above, which was received on January 20, 2017 (date of original deposit) 1 IV. INTERNATIONAL DEPOSITORY AUTHORITY Name: Korean Culture Center of MicroorganismsAddress: Yurim B / D45, Hongjenae-2ga-gil Soedaemun-guSEOUL 120-861Republic of Korea Signature (s) of the person (s) empowered to represent the International Depositary Authority or authorized official (s):Date: September 20, 2017 1 When Regulation 6.4 (d) applies, such date is the date on which the status of the international depositary authority was acquired: where a deposit made outside the Budapest Treaty after the acquisition of the status of the international depositary authority is converted into a deposit under the Budapest Treaty, that date is the date on which the micro-organism was received by the international depositary authority. BP / 4 form (single page) Petition 870190084989, of 08/30/2019, p. 93/95 88/88 BUDAPEST TREATY ON RECOGNITION INTERNATIONAL DEPOSIT OF MICRO-ORGANISMS FOR THE PURPOSE OF PATENT PROCEDURE INTERNATIONAL FORM To: KIM DONG-HYUN RECEIPT IN CASE OF AN ORIGINAL issued in accordance with Regulation 7.1 by the INTERNATIONAL DEPOSITORY AUTHORITY identified in 92-24, Seonjam-Ro, Seonbuk-gu, Seoul, KOREA end of this page I. IDENTIFICATION OF MICRO-ORGANISM Identification reference provided byDEPOSIT ANTE:Lactobacillus plantarum IM76 Registration number provided by the DEPOSITORY AUTHORITYINTERNATIONAL:KCCM11962P II. SCIENTIFIC DESCRIPTION AND / OR PROPOSED TAXONOMIC DESIGNATION The microorganism identified in I above was accompanied by:□ a scientific description□ a proposed taxonomic designation(Check with a cross where applicable) III. RECEIPT AND ACCEPTANCE This International Depositary Authority accepts the microorganism identified in I above, which was received on January 20, 2017 (date of original deposit) 1 IV. INTERNATIONAL DEPOSITORY AUTHORITY Name: Korean Culture Center of MicroorganismsAddress: Yurim B / D45, Hongjenae-2ga-gil Soedaemun-guSEOUL 120-861Republic of Korea Signature (s) of the person (s) empowered to represent the International Depositary Authority or authorized official (s):Date: January 20, 2017 1 When Regulation 6.4 (d) applies, such date is the date on which the status of the international depositary authority was acquired: where a deposit made outside the Budapest Treaty after the acquisition of the status of the international depositary authority is converted into a deposit under the Budapest Treaty, that date is the date on which the micro-organism was received by the international depositary authority.
权利要求:
Claims (22) [1] 1. Bifidobacterium longum characterized by being IM55 KCCM11961P. [2] 2. Lactobacillus plantarum characterized by being IM76 KCCM11962P. [3] 3. Bifidobacterium longum IM55 KCCM11961P, according to claim 1, characterized in that said Bifidobacterium longum IM55 KCCM11961P comprises a 16S rDNA sequence of SEQ ID NO: 1. [4] 4. Bifidobacterium longum IM55 KCCM11961P, according to claim 1, characterized by the fact that said Bifidobacterium longum IM55 KCCM11961P uses as carbon source D-glucose, D-mannitol, D-lactose, D-sucrose, Dmaltose, salicine, D-xylose, L-arabinose, esculin ferric citrate, D-raffinose and D-sorbitol. [5] 5. Lactobacillus plantarum IM76 KCCM11962P, according to claim 2, characterized in that said Lactobacillus plantarum IM76 KCCM11962P comprises a sequence of 16S rDNA of SEQ ID NO: 2. [6] 6. Lactobacillus plantarum IM76 KCCM11962P, according to claim 2, characterized by the fact that said Lactobacillus plantarum IM76 KCCM11962P uses L-arabinose, D-ribose, D-galactose, D-glucose, D-fructose as carbon source, D-mannose, mannitol, sorbitol, N-acetylglucosamine, tonsillin, arbutin, esculin, salicine, cellobiose, maltose, lactose, melibiose, sucrose, trehalose, raffinose, gentiobiose, D-turanosis and gluconate. [7] 7. Pharmaceutical composition to prevent or treat allergic diseases characterized by including Bifidobacterium Petition 870190073347, of 7/31/2019, p. 95/115 2/4 longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof. [8] 8. Pharmaceutical composition, according to claim 7, characterized by the fact that said Bifidobacterium longum IM55 KCCM11961P is a living cell body of the same, a dead cell body of the same, a product of the culture of the same, a crushed product of the same or an extract from it. [9] 9. Pharmaceutical composition, according to claim 7, characterized by the fact that said Lactobacillus plantarum IM76 KCCM11962P is a living cell body of the same, a dead cell body of the same, a product of the same culture, a crushed product of the same or an extract from it. [10] 10. Pharmaceutical composition according to claim 7, characterized by the fact that said allergic diseases are at least one selected from the group comprising rhinitis, atopy, asthma, atopic dermatitis, allergic conjunctivitis, allergic otitis media, urticaria and anaphylactic shock. [11] Pharmaceutical composition according to claim 7, characterized in that said pharmaceutical composition additionally comprises at least one selected from the group that includes chitosan inulin and citrus pectin. [12] 12. Food composition to prevent or relieve allergic diseases characterized by comprising Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof. [13] 13. Food composition, according to the Petition 870190073347, of 7/31/2019, p. 96/115 3/4 claim 12, characterized by the fact that said Bifidobacterium longum IM55 KCCM11961P is a living cell body of the same, a dead cell body of the same, a product of the culture of the same, a crushed product of the same or an extract of the same. [14] 14. Food composition according to claim 12, characterized by the fact that said Lactobacillus plantarum IM76 KCCM11962P is a living cell body of the same, a dead cell body of the same, a product of the culture of the same, a crushed product of the same or an extract from it. [15] 15. Food composition according to claim 12, characterized by the fact that said allergic diseases are at least one selected from the group comprising rhinitis, atopy, asthma, atopic dermatitis, allergic conjunctivitis, allergic otitis, urticaria and anaphylactic shock. [16] 16. Food composition according to claim 12, characterized by the fact that said pharmaceutical composition additionally comprises at least one selected from the group that includes chitosan inulin and citrus pectin. [17] 17. Pharmaceutical composition to prevent or treat immune diseases or inflammatory diseases characterized by including Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof. [18] 18. Pharmaceutical composition to prevent or treat immune diseases or inflammatory diseases, according to claim 17, characterized by the fact that said Petition 870190073347, of 7/31/2019, p. 97/115 4/4 inflammatory diseases are colitis. [19] 19. Method for preventing or treating allergic diseases characterized by comprising a stage of administration of Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof to an individual. [20] 20. Use of Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof characterized for being to prevent or treat allergic diseases. [21] 21. Use of Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM7 6 KCCM11962P or mixtures thereof characterized for being to produce a drug to prevent or treat allergic diseases. [22] 22. Composition characterized by comprising Bifidobacterium longum IM55 KCCM11961P, Lactobacillus plantarum IM76 KCCM11962P or mixtures thereof for use in the prevention or treatment of allergic diseases.
类似技术:
公开号 | 公开日 | 专利标题 BR112019015806A2|2020-03-31|INNOVATIVE ACID-LACTIC BACTERIA AND USE OF THE SAME CN108473944B|2022-02-25|Novel lactobacillus having various functions and use thereof CA2778372C|2017-02-07|Novel lactobacillus plantarum and composition comprising the same BR112020015599A2|2021-01-05|LACTOBACILLUS PLANTARUM KBL396 CEPA AND USE OF THE SAME BR112020022749A2|2021-03-02|strain of lactobacillus paracasei and its use KR101937364B1|2019-01-11|Novel lactic acid bacteria having immunoregulatory activities derived from human digestive tract and use thereof KR101862051B1|2018-05-29|Novel lactic acid bacteria having immunoregulatory activities derived from human digestive tract and use thereof US11104878B2|2021-08-31|Lactic acid bacteria capable of controlling blood sugar and use thereof WO2018129722A1|2018-07-19|A novel lactic acid bacteria and its applications EP3578637A1|2019-12-11|Novel lactic acid bacteria and use thereof KR102224072B1|2021-03-10|Bifidobacterium longum subsp. longum having both abilities of reducing total cholesterol in serum and immune regulation and its application RU2766715C2|2022-03-15|New strain of bifidobacterium, characterized by different functions, and application thereof KR102297271B1|2021-09-03|Lactobacillus rhamnosus NBM 17-4 strain having preventive or therapeutic activity for metabolic disease including diabetes and hyperlipidemia KR102323673B1|2021-11-08|Manufacturing method for HtrA| chaperone probiotics and composition manufactured through thereof having the effect of controlling the intestinal microbiome for the treatment of inflammatory bowel disease KR101955275B1|2019-03-08|Lactobacillus paracasei HY7013 having esophageal protective effects and products containing thereof as effective component JP2020022488A|2020-02-13|Novel lactic acid bacteria having various functionalities and application thereof US20210138004A1|2021-05-13|Therapeutic uses of lactobacillus plantarum
同族专利:
公开号 | 公开日 RU2021118078A|2021-08-31| JP6839298B2|2021-03-03| AU2018216532B2|2021-06-03| CN110494551A|2019-11-22| KR20190082739A|2019-07-10| KR102036841B1|2019-10-25| SG10202107425VA|2021-08-30| SG10201913050RA|2020-03-30| AU2018216532A1|2019-08-15| KR101999259B1|2019-07-11| CA3052134A1|2018-08-09| MX2019009079A|2019-09-26| RU2019127021A|2021-03-02| WO2018143678A1|2018-08-09| JP2021078511A|2021-05-27| SG11201907043VA|2019-08-27| AU2021205078A1|2021-08-12| RU2019127021A3|2021-03-02| RU2752157C2|2021-07-23| JP2020515240A|2020-05-28| KR20180089324A|2018-08-08| RU2021118078A3|2022-01-19|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 KR20050076374A|2004-01-20|2005-07-26|김수남|Utility products comprising soy bean extract fermented by lactic acid bacteria inhibiting ammonia production, allergy, atopy and thereof method| JP5273695B2|2005-03-03|2013-08-28|株式会社明治|Allergy prevention and / or treatment agent containing bifidobacteria as an active ingredient| ES2590916T3|2005-10-06|2016-11-24|Probi Ab|Use of Lactobacillus for the treatment of virus infections| KR100715730B1|2005-11-15|2007-05-08|연세대학교 산학협력단|24A novel Bifidobacterium longum A24 with anti-bacterial activity against toxigenic pathogens| ES2381211T3|2006-02-15|2012-05-24|Nestec S.A.|Use of Bifidobacterium longum to prevent and treat inflammations| KR20080075971A|2007-02-14|2008-08-20|네오팜|Probiotics combined preparations| NZ580005A|2007-03-28|2012-03-30|Alimentary Health Ltd|Probiotic bifidobacterium strain 41382| KR101178217B1|2009-10-28|2012-09-07|씨제이제일제당 |Novel lactobacillus plantarum and compositions comprising the same| JP4942831B2|2010-03-19|2012-05-30|株式会社キティー|Antiallergic composition| ES2606679T3|2012-07-05|2017-03-27|Centro Nacional De Tecnologia Y Seguridad Alimentaria. Laboratorio Dei Ebro|Microparticles for the encapsulation of probiotics, obtaining and using them| KR20160069733A|2014-12-09|2016-06-17|바이오리듬|Lactobacillus plantarum, K-1 BR on antiallergic properties, anti atopic dermatitis, anti rhinitis, anti pruritus. egulation of level of immunity, microbial agent| KR101655778B1|2016-02-19|2016-09-09|대한민국|Lactobacillus plantarum K46 and composition comprising the same| KR101743044B1|2016-06-28|2017-06-02|바이오제닉스코리아 주식회사|The Functional Health Food For Improving The Intestine Function and Environment and Enhencing Immunity|CN109498660A|2018-11-23|2019-03-22|江南大学|A kind of application for the lactobacillus plantarum CCFM8610 that can alleviate atopic dermatitis| KR102074445B1|2018-12-12|2020-02-06|주식회사 비피도|Bifidobacterium longum RAPO for improvement, prevention or treatment of rheumatoid arthritis and composition comprising the same| CN109652349B|2019-02-25|2021-03-02|江南大学|Bifidobacterium longum capable of relieving atopic dermatitis and application thereof| KR20210023768A|2019-08-23|2021-03-04|연세대학교 산학협력단|A new symbiotic bacteria having ability to resistance under reactive oxygen species conditions and use thereof| KR102254310B1|2019-10-02|2021-05-21|주식회사 고바이오랩|Lactobacillus Acidophilus KBL409 and Use Thereof| KR102263698B1|2019-11-29|2021-06-09|롯데칠성음료주식회사|A mixture of Lactobacillus plantarum LRCC5195 and isomaltooligosaccharide having ameliorating or improving atopic dermatitis| CN110960562B|2019-12-31|2020-10-16|广州市爱百伊生物技术有限公司|Probiotic composition with anti-allergy effect| KR102162470B1|2020-03-19|2020-10-06|주식회사 비피도|Food composition for alleviation of Sjogren's syndrome and pharmaceutical composition with Bifidobacterium pseudocatenulatum C-RAPO , Bifidobacterium bifidum ATT | CN111647526A|2020-05-18|2020-09-11|深圳市华大农业应用研究院|Lactobacillus plantarum SD-H9, probiotic microbial inoculum thereof and application thereof| KR102268125B1|2021-02-09|2021-06-22|주식회사 락토메이슨|A novel strain of bifidobacterium longum lm1024 derived from korean infants, and composition for relieving premenstrual syndrome comprising the strain or its culture fluid| KR102294437B1|2021-02-17|2021-08-27|주식회사 메디오젠|Infant and child origin lactic acid bacteria Lactobacillus plantarum MG4553 and composition comprising the lactic acid bacteria for enhancing intestine activity, anti-oxidant and anti-obesity| KR102294442B1|2021-02-17|2021-08-27|주식회사 메디오젠|Infant and child origin lactic acid bacteria Lactobacillus plantarum MG4555 and composition comprising the lactic acid bacteria for enhancing intestine activity, anti-oxidant and anti-obesity| KR102360233B1|2021-03-26|2022-02-09|바이오일레븐|Lactobacillus fermentum having effects of preventing or improving oral disease and use thereof|
法律状态:
2021-10-13| B350| Update of information on the portal [chapter 15.35 patent gazette]|
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 KR20170013632|2017-01-31| KR10-2017-0013632|2017-01-31| PCT/KR2018/001359|WO2018143678A1|2017-01-31|2018-01-31|Novel lactic acid bacteria and use thereof| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|